SGN Marker TG476

SGN-M339

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG476 image not available
Forward sequence
GGGAGACAGCTTGCATGCCTGCAGCACAAGAAATAAATGAGTTAAATTCTAAAGGAACACTAGTCTGAATATAAACCACAAAAACTTGTT
TAGAAAGAAATCAGCACATATACTAAAAGAAAGATTTCAACTAAACCTACCATTGCTTTAAGCTCAAAACCTTTTGGTTTTTCAGCAAAC
TGGACAACTCTGCCTCTGCTGTCAATCTTGACCAGCCCAAAATCTGATGCTCGGCTGATAAGTAAAGCTTAAATCTCAGCTTAACATAAT
CACAATAAGGTATTAAAAAATGTGTTGATGTTTTTACTTCCAAGTAATGTATAGCGAGCGTATGCATATGAGTATTAGAGGAGAAGCATT
CTTTCTCCATCTTGTTTCTGATCTCACTCAATTCACTTAACCTATACTAGTTGTTCCTTATAAGAATTTAAACAAACCTGTCCTCAGCTG
GTGCACATGAAAGAGTAATATCAGCATTTCTGTCAATATGGTTCTGTTTGAAGATCGGAGGCAGTCAGAAACTTTGTTTTTTAAAAGAAA
AAAAAAAGGCAA
Reverse sequence
ATTAGGAGGAGGCGAAGGGACCAAGTTATTCCCACTTACAAGTAGAACTGCAACCCCTGCTGTAAGAGATTTATCTTTGCTCATGAAAGT
TTTATCAATTTTTTGTTTTATATGCTTAATGTCCAGTTAAAACTCTCTTCCAAGTTAATTTTGTTTATCTCGTGTTAAATTTCAGATTTT
TTTTTTTAATGATATGTTATTTTTTGATTTCTACATCGATTAAATATAGATAGAATAGGTGTACAAAATTGCAAGTCAATTTCTTAAAAT
TCTGATGTTTTGTGCAACATGGCACCAGGTTCCGGTTGGAGGATGCTACAGGCTGATAGACATCCCAATGAGCAACTGTATCAACAGTGC
TATTAACAAGATTTTTGTGCTGACACAGAACAATTCTGCTGCCCTAAATCGTCACATTGCT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8926)
Chromosome
1
Position
126.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG476 was used as an overgo probe on plate 3 [well H2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGCCTCTGCTGTCAATCTTGACCA
B sequence
GCATCAGATTTTGGGCTGGTCAAG
AB sequence
TGCCTCTGCTGTCAATCTTGACCAGCCCAA
Marker sequence
GGGAGACAGCTTGCATGCCTGCAGCACAAGAAATAAATGAGTTAAATTCT
AAAGGAACACTAGTCTGAATATAAACCACAAAAACTTGTTTAGAAAGAAA
TCAGCACATATACTAAAAGAAAGATTTCAACTAAACCTACCATTGCTTTA
AGCTCAAAACCTTTTGGTTTTTCAGCAAACTGGACAACTCTGCCTCTGCT
GTCAATCTTGACCAGCCCAAAATCTGATGCTCGGCTGATAAGTAAAGCTT
AAATCTCAGCTTAACATAATCACAATAAGGTATTAAAAAATGTGTTGATG
TTTTTACTTCCAAGTAATGTATAGCGAGCGTATGCATATGAGTATTAGAG
GAGAAGCATTCTTTCTCCATCTTGTTTCTGATCTCACTCAATTCACTTAA
CCTATACTAGTTGTTCCTTATAAGAATTTAAACAAACCTGTCCTCAGCTG
GTGCACATGAAAGAGTAATATCAGCATTTCTGTCAATATGGTTCTGTTTG
AAGATCGGAGGCAGTCAGAAACTTTGTTTTTTAAAAGAAAAAAAAAAGGC
AA
Genomic location of TG476  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D339 marker 339
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)