SGN Marker CT285

SGN-M3398

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53471)
Chromosome
6
Position
23.83 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato-LXCHM 2007   
Map version
68 (location: 42967)
Chromosome
6
Position
16.70 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43967
Forward primer (5'-3')
GGGAATCACCAAAGGAACAG
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
TCCATGCTGTATTTGTAGTGTCA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 1992   
Map version
28 (location: 13344)
Chromosome
6
Position
27.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Genomic location of CT285  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3398 marker 3398
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)