SGN Marker TG26

SGN-M34

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2400
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
TG26 image not available
Forward sequence
TCTTGCCAAAAGCTTTCTAACTGGTCATGGGTAAACCAATCTTCCTTCATCTATAAAACAGAAAAAGATTATAAGGATTAGAGGATTTCT
TGATATGAAGATTTGTTGAAGAGAACGACCATATCGTCTAAAAGTTTAAAATGTTAAGAGAGGGGACACTTTTATTTATTCAGTGCGCTC
CCTCACGTGCTGGCTTGAATATTTTTTCATGAGACTATCACGTGGATATGTGTTAAAGTTTGTGAGGGAATACTTCTATTTATTTGATTA
TCTAAATAGTTTGACAAAGTACTCACAAAGTAAGGGTAGCCTTCTGAAATGCTAAAAGTTTATGGAGCATTCTCTAGGAAAAGGCTAATG
TTGTGCAAAACAGATTTACCACAGTCGGTAACAGTTCTATGTTGCGGTACCTGAAACGTTCAAGTTGCTCTAAA
Reverse sequence
ATCTTTGTCATCTCTATCATTAAGTTTTATTCCCAGTCAAGAAGACTTGATAACGCTTCTCCGAAATTGTTCTTTTGTTTCTGTTAGAGT
ATCAACAGGAACAGGAATCTTTTCGAAGTCCTACTTCTATATCCTTTGCATCCCTCAATTCACGATATGATGCCTAACAGAAGCAGAAAT
GGTTATATCCTTTTGCTTTCTTTTTTTTAATCATCCCAATTACTGTTATTTTCTCTTTTCTTTTACATTTACTTATATAGACTGATTATT
TGGTTCAGTCGTGGAGCCACGGCGTACTTCCCGCCTGCGTGACCTGGAAAATAGAAGGAACAACAAATGAGA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53528)
Chromosome
11
Position
108.81 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53239)
Chromosome
11
Position
45.02 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_11 MQTL_1_Maturity_11 MQTL_2_Late_blight_11 MQTL_2_Maturity_11
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42427)
Chromosome
12
Position
87.50 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39966)
Chromosome
11
Position
92.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 7815)
Chromosome
12
Position
84.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7814)
Chromosome
11
Position
83.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 7813)
Chromosome
11
Position
45.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG26 was used as an overgo probe on plate 10 [well D7]

Plausible BAC Matches:   P013I21

 Overgo Sequences

A sequence
ACCACAGTCGGTAACAGTTCTATG
B sequence
GTTTCAGGTACCGCAACATAGAAC
AB sequence
ACCACAGTCGGTAACAGTTCTATGTTGCGG
Marker sequence
TCTTGCCAAAAGCTTTCTAACTGGTCATGGGTAAACCAATCTTCCTTCAT
CTATAAAACAGAAAAAGATTATAAGGATTAGAGGATTTCTTGATATGAAG
ATTTGTTGAAGAGAACGACCATATCGTCTAAAAGTTTAAAATGTTAAGAG
AGGGGACACTTTTATTTATTCAGTGCGCTCCCTCACGTGCTGGCTTGAAT
ATTTTTTCATGAGACTATCACGTGGATATGTGTTAAAGTTTGTGAGGGAA
TACTTCTATTTATTTGATTATCTAAATAGTTTGACAAAGTACTCACAAAG
TAAGGGTAGCCTTCTGAAATGCTAAAAGTTTATGGAGCATTCTCTAGGAA
AAGGCTAATGTTGTGCAAAACAGATTTACCACAGTCGGTAACAGTTCTAT
GTTGCGGTACCTGAAACGTTCAAGTTGCTCTAAA
Genomic location of TG26  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D34 marker 34
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)