SGN Marker TG28

SGN-M340

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TGGCTGTGGTTAGAAGGTATTGCATATCTCATACGCGCTCTTGAATTTTGAACGATTTCTACTTGATAACTCATACGTGTACTATACATG
GTTCGATCACAGAAAACTTAGCAGTAAAAACAGATTTTGTGCTTAAATATCAGTTTGTGCTCTCTACATTAGTTGAATTTCCCTAACATA
CAAACTATAGGGTCTAAGGCCAACAATTCCCGCGAACACTCATCCAATGTTGGTAGACTTGCTCGAGAAATGCTGGCAGCAAGAACCGCT
CTTAAGACCTGAATTCTCCGAGATACTTGACATCTTACAAGACATGACCAAAAAGGTACTCGTCGTGGTAGCAGAATTAGATTCAATGTG
ATTTCTGCATTTTGTTTTGTGTTTGTGAAAACTCTGCTTAAACACAGATGGTTGAAGAAGAGAAAAGTAGCAAAAGAAGAAGCCTTGGAT
AACCATTAAGGAAGCAGAATGCATAATACGTATTTTACTTTTAAGTTAAAGTTATATATACTGACAGTGTTGTATGACTATGATCTGTGG
TAGTAGATTTAGCTA
Reverse sequence
TGGGCTGCGTGGCTGTGGTTAGAAGGTATTGCATATCTCATACGCGCTCTTGAATTTTGAACGATTTCTACTTGATAACTCATACGTGTA
CTATACATGGTTCGATCACAGAAAACTTAGCAGTAAAAACAGATTTTGTGCTTAAATATCAGTTTGTGCTCTCTACATTAGTTGAATTTC
CCTAACATACAAACTATAGGGTCTAAGGCCAACAATTCCCGCGAACACTCATCCAATGTTGGTAGACTTGCTCGAGAAATGCTGGCAGCA
AGAACCGCTCTTAAGACCTGAATTCTCCGAGATACTTGACATCTTACAAGACATGACCAAAAAGGTACTCGTCGTGGTAGCAGAATTAGA
TTCAATGTGATTTCTGCATTTTGTTTTGTGTTTGTGAAAACTCTGCTTAAACACAGATGGTTGAAGAAGAGAAAAGTAGCAAAAGAAGAA
GCCTTGGATAACCATTAAGGAAGCAGAATGCATAATACGTATTTTACTTTTAAGTTAAAGTTATATATACTGACAGTGTTGTATGACTAT
GATCTGTGGTAGTAGATTTAGCTACAACTTCTCTTA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53253)
Chromosome
3
Position
103.47 cM
Confidence
uncalculated
Protocol
unknown
Subscript
A

MQTL_1_Late_blight_3 MQTL_2_Late_blight_3 MQTL_3_Late_blight_3
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53254)
Chromosome
12
Position
53.02 cM
Confidence
uncalculated
Protocol
unknown
Subscript
B

MQTL_2_Late_blight_12 MQTL_1_Late_blight_12
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53249)
Chromosome
12
Position
21.94 cM
Confidence
uncalculated
Protocol
unknown

MQTL_2_Late_blight_12 MQTL_1_Late_blight_12
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8928)
Chromosome
12
Position
67.30 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8929)
Chromosome
12
Position
41.00 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8927)
Chromosome
12
Position
51.00 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG28 was used as an overgo probe on plate 16 [well D9]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P002I05,   P099L21,   P099L22

 Overgo Sequences

A sequence
TAGGGTCTAAGGCCAACAATTCCC
B sequence
TTGGATGAGTGTTCGCGGGAATTG
AB sequence
TAGGGTCTAAGGCCAACAATTCCCGCGAAC
Marker sequence
TGGCTGTGGTTAGAAGGTATTGCATATCTCATACGCGCTCTTGAATTTTG
AACGATTTCTACTTGATAACTCATACGTGTACTATACATGGTTCGATCAC
AGAAAACTTAGCAGTAAAAACAGATTTTGTGCTTAAATATCAGTTTGTGC
TCTCTACATTAGTTGAATTTCCCTAACATACAAACTATAGGGTCTAAGGC
CAACAATTCCCGCGAACACTCATCCAATGTTGGTAGACTTGCTCGAGAAA
TGCTGGCAGCAAGAACCGCTCTTAAGACCTGAATTCTCCGAGATACTTGA
CATCTTACAAGACATGACCAAAAAGGTACTCGTCGTGGTAGCAGAATTAG
ATTCAATGTGATTTCTGCATTTTGTTTTGTGTTTGTGAAAACTCTGCTTA
AACACAGATGGTTGAAGAAGAGAAAAGTAGCAAAAGAAGAAGCCTTGGAT
AACCATTAAGGAAGCAGAATGCATAATACGTATTTTACTTTTAAGTTAAA
GTTATATATACTGACAGTGTTGTATGACTATGATCTGTGGTAGTAGATTT
AGCTA
Genomic location of TG28  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D340 marker 340
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)