Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker TG477

SGN-M341

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1600
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
ATAAAGAACAAACTGTCTCGTCTGAAATTTAGAGCAAAACTATTGATGTTTTTGCAGAATCAAAACTCCTAGTAATAGTTCAGCTTGCCT
ATTAGGATTAATGCTAGGACAATCAACTCTCCCACTTCTTTCCTCTCAAACTTCAGTCAAATGCTTTATCTTAATTTCTTCTTATGGGCC
TTCCACTGCTTCATTATGTGTTCAACTCCTTCTTTCAATGACACAATTCTTTTTTCCTTGTAATGCCACAACGCAGGTACTGGGTACCTG
CCACTGGGGTTATGCTCATTCAACTCGTTTAACGCAGTTACAACAGATTGATAAACTTCATCACCATATTCGGCCTTTAGTTCCTTCAAT
TTCTCATCATCATCATCAATTATTTCCTAAGCAAATAAAAATTGAATGAGTAAAGATTTAAAAAAACAAAAACAAAAACAAAGAATACAT
GTAATAATAGTTAAAAAGTGTACATACCTCAGCAGTATGACCCTTTTG
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGTCAGTTCAAGAAGAAATCAAGGAGAGTGAAGAAGAACTTGATAGCTTGGAAACACTGAATCAAGCTC
TAATTATAAAGGAAAGACTTACGAATGATGAGGTGCAGGAAGCCTGTAAAGAATTAATCCATGTGAGTATTTTACCTTATTAATTCATCT
TCATGAATATTTGTTTACAATGAAGCAATGTGATTTTACTCTACGAAAATTGGAGGTAAACATATATGCTTTAGAAAGGTTTTGGTTACT
TTATTCTTGTTCACCAGCACGAGCAGCGAATCCTTCTATTTGTTAAGGAGTGAGTACACCATAGATCTGCCTTTTTAGGAAGTCGAGCAG
ACGCTTTTCATTCTTCACGCATTTGCTTCAATGATACTTGCCCATTAATTAGTTTGTATTGGGGGATTCAATCTAGAACTACATCTTCAC
AATCAATAAAATGCTCAGCAGTGTTAAAAAGAAGAAAAAAGAATAGTGCCAGGACATATTGGTATTTGCTAGCAAGATCCAGTGCCTAAA
TGAATTCT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53560)
Chromosome
6
Position
61.11 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8930)
Chromosome
6
Position
100.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8931)
Chromosome
6
Position
72.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG477 was used as an overgo probe on plate 3 [well A12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGACAATCAACTCTCCCACTTCTT
B sequence
CTGAAGTTTGAGAGGAAAGAAGTG
AB sequence
GGACAATCAACTCTCCCACTTCTTTCCTCT
Marker sequence
ATAAAGAACAAACTGTCTCGTCTGAAATTTAGAGCAAAACTATTGATGTT
TTTGCAGAATCAAAACTCCTAGTAATAGTTCAGCTTGCCTATTAGGATTA
ATGCTAGGACAATCAACTCTCCCACTTCTTTCCTCTCAAACTTCAGTCAA
ATGCTTTATCTTAATTTCTTCTTATGGGCCTTCCACTGCTTCATTATGTG
TTCAACTCCTTCTTTCAATGACACAATTCTTTTTTCCTTGTAATGCCACA
ACGCAGGTACTGGGTACCTGCCACT
Genomic location of TG477  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D341 marker 341
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)