SGN Marker TG29

SGN-M342

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pUC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
TG29 image not available
Forward sequence
GGAGGAAAGTCACAAATGTTGGTCAAGGTGCAGTTACTTATAAAGCTAAGATAAAAAAAACCCAAGAACTCAAAAGTTTCAGTGTCACCA
CAAACTTCGATGTTCAAGAATAAAAATGAGAAGCAAAGCTATATTTTGACAATTCGTTATATAGGTCCCAATAGAAACTATGGGTCGATC
ACTTGGGTTGAAGAGAACGGAAATCATACTCTTAGGAGTCCTATAGTGATATCTCCCATGATTGAATTGGAAGTACCAAACACAAGAACA
AAGGAAAGCTGAAAGCAAAATGGTAAATGTGTAAGCTCTATGAATTGCCTGTACTATCTTAAACAAACAAATAACAGTGGTCCTTCCGTC
CCTCTTTCGCCCAATTTTGTGCTAGTCTTTAATTTTGTATCATAATATTTCATAAGTTATACTTTCGTGCCTTTAAAGGACTTATGCCCC
GCTAGACATAAGTTCAATTTCTAAGAACAAAAATTACAAACCACCCATGTGAAGGGTAAATTAAAGATCACCTCATTTG
Reverse sequence
GGAGGAAAGTCACAAATGTTGGTCAAGGTGCAGTTACTTATAAAGCTAAGATAAAAAAAACCCAAGAACTCAAAAGTTTCAGTGTCACCA
CAAACTTCGATGTTCAAGAATAAAAATGAGAAGCAAAGCTATATTTTGACAATTCGTTATATAGGTCCCAATAGAAACTATGGGTCGATC
ACTTGGGTTGAAGAGAACGGAAATCATACTCTTAGGAGTCCTATAGTGATATCTCCCATGATTGAATTGGAAGTACCAAACACAAGAACA
AAGGAAAGCTGAAAGCAAAATGGTAAATGTGTAAGCTCTATGAATTGCCTGTACTATCTTAAACAAACAAATAACAGTGGTCCTTCCGTC
CCTCTTTCGCCCAATTTTGTGCTAGTCTTTAATTTTGTATCATAATATTTCATAAGTTATACTTTCGTGCCTTTAAAGGACTTATGCCCC
GCTAGACATAAGTTCAATTTCTAAGAACAAAAATTACAAACCACCCATGTGAAGGGTAAATTAAAGATCACCTCATTTGAAGGGAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1440923.7e-0524 (4.5% of RFLP seq)+
SGN-U1655513.7e-0528 (5.3% of RFLP seq)+
SGN-U1433516.1e-0731 (5.9% of RFLP seq)+
SGN-U1433573.9e-0845 (8.5% of RFLP seq)+
SGN-U1433563.9e-0845 (8.5% of RFLP seq)+
SGN-U1433563.9e-0865 (12.3% of RFLP seq)+
SGN-U1604796.3e-1064 (12.1% of RFLP seq)+
SGN-U1433511.8e-22154 (29.1% of RFLP seq)+
SGN-U1433491.8e-22154 (29.1% of RFLP seq)+
SGN-U1433501.2e-2391 (17.2% of RFLP seq)+
SGN-U1440923.8e-0524 (4.5% of RFLP seq)-
SGN-U1655513.8e-0528 (5.2% of RFLP seq)-
SGN-U1433516.1e-0731 (5.8% of RFLP seq)-
SGN-U1433573.9e-0845 (8.4% of RFLP seq)-
SGN-U1433563.9e-0845 (8.4% of RFLP seq)-
SGN-U1433563.9e-0865 (12.1% of RFLP seq)-
SGN-U1604796.4e-1064 (11.9% of RFLP seq)-
SGN-U1433511.9e-22154 (28.7% of RFLP seq)-
SGN-U1433491.9e-22154 (28.7% of RFLP seq)-
SGN-U1433501.2e-2391 (16.9% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53255)
Chromosome
1
Position
49.14 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_1 MQTL_2_Late_blight_1
Potato meta-QTL consensus map

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8932)
Chromosome
1
Position
83.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8933)
Chromosome
1
Position
36.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8934)
Chromosome
1
Position
18.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG29 was used as an overgo probe on plate 14 [well D11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AACAGTGGTCCTTCCGTCCCTCTT
B sequence
GCACAAAATTGGGCGAAAGAGGGA
AB sequence
AACAGTGGTCCTTCCGTCCCTCTTTCGCCC
Marker sequence
GGAGGAAAGTCACAAATGTTGGTCAAGGTGCAGTTACTTATAAAGCTAAG
ATAAAAAAAACCCAAGAACTCAAAAGTTTCAGTGTCACCACAAACTTCGA
TGTTCAAGAATAAAAATGAGAAGCAAAGCTATATTTTGACAATTCGTTAT
ATAGGTCCCAATAGAAACTATGGGTCGATCACTTGGGTTGAAGAGAACGG
AAATCATACTCTTAGGAGTCCTATAGTGATATCTCCCATGATTGAATTGG
AAGTACCAAACACAAGAACAAAGGAAAGCTGAAAGCAAAATGGTAAATGT
GTAAGCTCTATGAATTGCCTGTACTATCTTAAACAAACAAATAACAGTGG
TCCTTCCGTCCCTCTTTCGCCCAATTTTGTGCTAGTCTTTAATTTTGTAT
CATAATATTTCATAAGTTATACTTTCGTGCCTTTAAAGGACTTATGCCCC
GCTAGACATAAGTTCAATTTCTAAGAACAAAAATTACAAACCACCCATGT
GAAGGGTAAATTAAAGATCACCTCATTTG
Genomic location of TG29  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D342 marker 342
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)