SGN Marker TG478

SGN-M343

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1300
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG478 image not available
Forward sequence
CTGCTGATGGATTTTGATCACTGCATTCACTCATAAGAATGAAAACATTAACATGAGAATGTGCTACAAACGAAGTATATATAGCTTTAA
GTGTTATAAAAAATACCATCAAATATAAACTACACGGCTAAAGGCAACAAGTTCATATGCACAGAAAACATTTGAAAATAAGGGAGGCGC
TTAAAAGCTAAAAGAAAAAGGACAAATTGAATTAAATATTTTACGTCTCAAACTTCTAGAAGATTTTTCTAAAATATAGAATTATTGGCT
TCTGTCCAAGAAATTTATTCTCAAAATTTGTAGAAAAAAATTAATTCACAATTGTTTAATATTTTGAAGTAGTTTTTACAAAAAGACATC
CAGAAACTGTGTTTCTGAAGTTGCAGCTTGAGGGTGTTTTCAAACGAGAATTTTGCATATTAATTAAAGAAAAAACTATTCTTCTACTCG
CAAAACACTCACTTCCACAAGTTTTTTTCATGTAGAAGCAACACCTACCAA
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGATAGAACTTAGAAAAGAAGTGCATACAATTAATTGATGGATGCCTACATATATACATGAGCTCACAA
AAAGTACGTTATGCATTATATAAGGGTATTAATGTGGGAATGGCTTATCTGGAAGCCCACTTTTGCAGAAATACTAAACTGGATATTCAA
ATAATATTTGTCAATATTTTGAAGATTGAACTTTTAGCTACTGAAGTCATTCAGTGATGCTTTGTTTATTCTCTAGGTTCTCATTACTCA
ATCTTCAATTTTCCATACAGTTGCCACCTGCATATGGCTTTGGCAAACTCTATGAAACATTCCACTAACGATACCATCTGCATATGATTT
GAAATAACTTGAAAACAACTTGGGCTGGCTTTCCCAAACCAAAAGCCAATGATTAATCTTTTTCCTTAGCAAAATCTGATTTTGAAACCA
ACCTTCCTAACCAACCCGTACCCAAACATACAACTTTCTTCCATAATTAAAGGATACTTAGCTTTATTGAATATCCGTTACCT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8936)
Chromosome
8
Position
48.50 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8935)
Chromosome
5
Position
42.80 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG478 was used as an overgo probe on plate 15 [well B3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGACATCCAGAAACTGTGTTTCTG
B sequence
CCTCAAGCTGCAACTTCAGAAACA
AB sequence
AGACATCCAGAAACTGTGTTTCTGAAGTTG
Marker sequence
CTGCTGATGGATTTTGATCACTGCATTCACTCATAAGAATGAAAACATTA
ACATGAGAATGTGCTACAAACGAAGTATATATAGCTTTAAGTGTTATAAA
AAATACCATCAAATATAAACTACACGGCTAAAGGCAACAAGTTCATATGC
ACAGAAAACATTTGAAAATAAGGGAGGCGCTTAAAAGCTAAAAGAAAAAG
GACAAATTGAATTAAATATTTTACGTCTCAAACTTCTAGAAGATTTTTCT
AAAATATAGAATTATTGGCTTCTGTCCAAGAAATTTATTCTCAAAATTTG
TAGAAAAAAATTAATTCACAATTGTTTAATATTTTGAAGTAGTTTTTACA
AAAAGACATCCAGAAACTGTGTTTCTGAAGTTGCAGCTTGAGGGTGTTTT
CAAACGAGAATTTTGCATATTAATTAAAGAAAAAACTATTCTTCTACTCG
CAAAACACTCACTTCCACAAGTTTTTTTCATGTAGAAGCAACACCTACCA
A
Genomic location of TG478  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D343 marker 343
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)