SGN Marker TG110

SGN-M344

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
500
Vector
pUC
Cutting Site
SRD/PST1
Drug Resistance
AMP
Image
Forward sequence
GGGGATCGTCGACCTGCAGGGGGCTCAGACCCCTTACTCAAGAGGGCTTCTCTTCCTCTTATTGTCAGAAGTCAAATGGTTAAGTCCAGT
TGGGGCAACTGGGCCAGACGACATTGATAGCGGAGTTTCCGTGGTAAGGTACAAAGCTTTTTGTCTGGGTCTTGGGCAGACGTACTCAAC
TGGTACAAATAGAAAGGCTCGTCCAGTGAGTGATGACACTAGCGAGTAAACTGCAAAAGGGTCTTGCTTGGTATAATATAAGCGGATGAC
TTAGTTATAATTAGCTCAGATGTGACTTCTTTGCTCGGTTTCGGTTGCTTGACTCAATAATGGCCCTTCAAAGTCATTGACTCCATATTT
AGGGAACGGTTGAACTCCTTTTTTCTTTTTCAAGCTGTCGACAGTCATGTTCTTATATTTCTTTACTGTTCCGTACTAAATTCCTTTGTT
CACCAATCAACTGACCCCCCCCCCCCCTGCAGC
Reverse sequence
GGGGGGGGGGGGTCAGTCGATTGGTGAAAAAGGAATTTAGTACGGAACAGTAAAGAAATATAAGAACATGACTGTCGACAGCTTGAAAAA
GAAAAAAGGAGTTCAACCGTTCCCTAAATATGGAGTCAATGACTTTGAAGGGCCATTATTGAGTCAAGCAACCGAAACCGAGCAAAGAAG
TCACATCTGAGCTAATTATAACTAAGTCATCCGCTTATATTATACCAAGCAAGACCCTTTTGCAGTTTACTCGCTAGTGTCATCACTCAC
TGGACGAGCCTTTCTATTTGTACCAGTTGAGTACGTCTGCCCAAGACCCAGACAAAAAGCTTTGTACCTTACCACGGAAACTCCGCTATC
AATGTCGTCTGGCCCAGTTGCCCCAACTGGACTTAACCATTTGACTTCTGACAATAAGAGGAAGAGAAGCCCTCTTGAGTAAGGGCTCTT
GAGCCCCCTGCAGGTCGACGGATCCCCGG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U167683404 (83.6% of RFLP seq)+
SGN-U167683412 (86.0% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8937)
Chromosome
11
Position
54.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG110 was used as an overgo probe on plate 11 [well D3]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P244A14,   P233G05,   P210E08,   P139I21,   P131L15,   P194N05,   P074E19,   P233O04,   P101L23,   P124H06,   P223G10,   P237L15,   P234D05,   P175E16,   P148L07,   P278A04,   P257L16,   P306P07,   P115L15,   P328E13,   P022G24,   P177J24,   P162D18,   P265F18,   P199P16,   P224M05,   P318G02,   P220G04,   P281O03,   P038M19,   P310L15,   P021C19,   P105I10,   P036P11,   P143A10,   P264A05,   P314A24,   P185G24,   P054F23,   P214H10,   P328L21,   P176A13,   P278O11,   P329B17,   P034D09,   P332M13,   P199F20,   P163L21,   P249E13,   P177O19,   P296P16,   P095L13,   P281H13,   P076E08,   P136P14,   P030J18,   P308G14,   P144J19,   P257K15,   P013G04,   P006A15,   P139H17,   P022J14,   P029M10,   P039J07,   P141C23,   P320K06,   P178K13,   P028C09,   P221K24,   P042N22,   P284O08,   P133G22,   P138L23

 Overgo Sequences

A sequence
GCTCAGATGTGACTTCTTTGCTCG
B sequence
GTCAAGCAACCGAAACCGAGCAAA
AB sequence
GCTCAGATGTGACTTCTTTGCTCGGTTTCG
Marker sequence
GGGGATCGTCGACCTGCAGGGGGCTCAGACCCCTTACTCAAGAGGGCTTC
TCTTCCTCTTATTGTCAGAAGTCAAATGGTTAAGTCCAGTTGGGGCAACT
GGGCCAGACGACATTGATAGCGGAGTTTCCGTGGTAAGGTACAAAGCTTT
TTGTCTGGGTCTTGGGCAGACGTACTCAACTGGTACAAATAGAAAGGCTC
GTCCAGTGAGTGATGACACTAGCGAGTAAACTGCAAAAGGGTCTTGCTTG
GTATAATATAAGCGGATGACTTAGTTATAATTAGCTCAGATGTGACTTCT
TTGCTCGGTTTCGGTTGCTTGACTCAATAATGGCCCTTCAAAGTCATTGA
CTCCATATTTAGGGAACGGTTGAACTCCTTTTTTCTTTTTCAAGCTGTCG
ACAGTCATGTTCTTATATTTCTTTACTGTTCCGTACTAAATTCCTTTGTT
CACCAATCAACTGACCCCCCCCCCCCCTGCAGC
Genomic location of TG110  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D344 marker 344
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)