SGN Marker TG112

SGN-M345

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
350
Vector
pUC
Cutting Site
SRD/PST1
Drug Resistance
AMP
Image
TG112 image not available
Forward sequence
ATCGTCGACCTGCAGGGGGGGGGGGCTGAATCAAGAAAAATTCAAGGAAATTTAAGACTCAAGTTGAGTTCAAAGAGTTTTTCAAAAGTC
TTTCCCGAACGTTTTAACTTTGTTTAAGACTTGAGTTCTGAGTTATGAAAAAATTAAAGAGTCGAGTTCATTTCTTCAAAATTTATACGG
AACTAAGTATTCCCAAGAGTTAAATGTTGTCACATTTAGACAAGAGAGGAAACACAGATTTTCAAGAGAGCTTTTAAGCTAAGTTTTGAG
TAATTATCTCAAATCAAAGAAAGATTTTTTTACAAACATATGAGCTCAGTCCCCCCCCCCCTGCAGC
Reverse sequence
GGGGGGGGGGGACTGAGCCATATGTTTGTAAAAAATCTTTCTTTGATTTGAGATAATTACTCAAAACTTAGCTTAAAAGCTCTCTTGAAA
ATCTGTGTTTCCTCTCTTGTCTAAATGTGACAACATTTAACTCTTGGGAATACTTAGTTCCGTATAAATTTTGAAGAAATGAACTCGACT
CTTTAATTTTTTCATAACTCAGAACTCAAGTCTTAAACAAAGTTAAAACGTTCGGGAAAGACTTTTGAAAAACTCTTTGAACTCAACTTG
AGTCTTAAATTTCCTTGAATTTAATTTTGGATTCAACCCCCCCCCCCTGCAGGTCGACGGATCCCCGG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1654903.9e-1052 (15.4% of RFLP seq)+
SGN-U1654903.9e-1052 (15.4% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8938)
Chromosome
12
Position
41.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG112 was used as an overgo probe on plate 6 [well E2]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P110D13,   P219N20,   P037H17,   P128K21,   P110L19,   P019J05,   P014I12,   P104M02,   P147C18,   P209F24,   P216A14,   P132A04,   P046K15,   P169H08,   P041O14,   P116B21,   P003O07,   P264H08,   P160P13,   P189D12,   P060J21

 Overgo Sequences

A sequence
TTCCCAAGAGTTAAATGTTGTCAC
B sequence
CCTCTCTTGTCTAAATGTGACAAC
AB sequence
TTCCCAAGAGTTAAATGTTGTCACATTTAG
Marker sequence
ATCGTCGACCTGCAGGGGGGGGGGGCTGAATCAAGAAAAATTCAAGGAAA
TTTAAGACTCAAGTTGAGTTCAAAGAGTTTTTCAAAAGTCTTTCCCGAAC
GTTTTAACTTTGTTTAAGACTTGAGTTCTGAGTTATGAAAAAATTAAAGA
GTCGAGTTCATTTCTTCAAAATTTATACGGAACTAAGTATTCCCAAGAGT
TAAATGTTGTCACATTTAGACAAGAGAGGAAACACAGATTTTCAAGAGAG
CTTTTAAGCTAAGTTTTGAGTAATTATCTCAAATCAAAGAAAGATTTTTT
TACAAACATATGAGCTCAGTCCCCCCCCCCCTGCAGC
Genomic location of TG112  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D345 marker 345
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)