SGN Marker TG116

SGN-M347

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
TG116 image not available
Forward sequence
AGAGGAGAAGTGAAGAACAGAAAACGAATGGGAAAGAGAAGAAGAAAAAATCGAAGAAAGAGGAGACAAGAAGAAGACAAGACCTTACCT
TGAAATCCTAGAACTGGGAAAAGCAACGGCAAGAAGAACCGAAAATATGCTAAGATTGTTGCAATCTTTAAAAAAAATAGACCTAAAAAA
TGCTTCACACTCGCCCCACTTTTCGCTTCTTCAGCAGAAGAAGAGGTCTCTTTTAATCTCGCCTCACTTTAGTGCCCTGAAGCGCTTGAC
CCTCGCTCCACGCTTTAAGCGCTGAAGCGAGCGTAACACTGGTTTACTCCCTTTCACCTCTCAAACATATTAAAAGAACTAGTTTTTTGA
GTGAAGTTACCATTTGACAGTTGCAGACTACCAAATAACAGCTCATGAAAGCTCACTGCTAAGGAAGTTACTAAGCAGCGACACAGGCAA
TAT
Reverse sequence
not available
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53866)
Chromosome
1
Position
0.00 cM
Confidence
uncalculated
Protocol
RFLP

Hexanal_content_hxa1_1 Pentanal_content_pna1_1 Titratable_acidity_ta1_1 Elasticity_ela1_1
Tomato QTL map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53160)
Chromosome
1
Position
83.21 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_1 MQTL_2_Late_blight_1
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8942)
Chromosome
1
Position
76.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8943)
Chromosome
1
Position
49.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG116 was used as an overgo probe on plate 15 [well C3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTTTAAGCGCTGAAGCGAGCGTAA
B sequence
AGGGAGTAAACCAGTGTTACGCTC
AB sequence
CTTTAAGCGCTGAAGCGAGCGTAACACTGG
Marker sequence
AGAGGAGAAGTGAAGAACAGAAAACGAATGGGAAAGAGAAGAAGAAAAAA
TCGAAGAAAGAGGAGACAAGAAGAAGACAAGACCTTACCTTGAAATCCTA
GAACTGGGAAAAGCAACGGCAAGAAGAACCGAAAATATGCTAAGATTGTT
GCAATCTTTAAAAAAAATAGACCTAAAAAATGCTTCACACTCGCCCCACT
TTTCGCTTCTTCAGCAGAAGAAGAGGTCTCTTTTAATCTCGCCTCACTTT
AGTGCCCTGAAGCGCTTGACCCTCGCTCCACGCTTTAAGCGCTGAAGCGA
GCGTAACACTGGTTTACTCCCTTTCACCTCTCAAACATATTAAAAGAACT
AGTTTTTTGAGTGAAGTTACCATTTGACAGTTGCAGACTACCAAATAACA
GCTCATGAAAGCTCACTGCTAAGGAAGTTACTAAGCAGCGACACAGGCAA
TAT
Genomic location of TG116  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D347 marker 347
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)