SGN Marker TG117

SGN-M348

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2100
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
TG117 image not available
Forward sequence
CTTTTGGTGGCACGTGAGTGTGTGTGGGCGGTCCTCTTTCTTAGTGGTTGACTGGGTTTTTCATTGGCAGGTGGGGGACCTCTTGTGATG
TTTTCGCACAACATTCGAATGATACATCATCCTATAGAGTTTTCTGAAAATTGAAGCACATTGATTGTGTGGCTGTCTTTTCTTTCCCAG
ATATTTCTCACAATGTTCTGATACCATGTGAGAAGTAAAGACACGGAAAACATTATAAAAAATTGTATTTACATTATTACACTGAGCTCT
ATTTATAGTTATATTTTACATAATACATAATAATCCTATTTTAAGTGGGACACGATATACATTAATATTCTAACAGATCCTATGTGAGTT
CATGAATTTCTCTGGAGAAGATAAATATTATATTGCATTATCATCACGAAAAGAGCGGTATACAAATCTCAAATTGATTTTGGATTTCAT
CATAAAAACTGTAAAAAATAGACAACTTGGATCGATTTTTCATCAAGAA
Reverse sequence
ATTATTTAATCCCTTTCTCTTATCATTAGATGCTTCCCTGAGGGTGAAGCAGATCCATTACATGATTTTTTTCTGCTCCTTTCAGCCCAT
TCATATCACACTGTTCCCTTCAGATCTCCATCTAGTAATATCATATGATTTGAAGCCACCATAAAAATAAATCCTATTTTCCCCCATAGA
TAAGGACCAAAAATTAACGGACTAAATTTGAGAAATAAACTATCACATAGGTAATAGTTCAAGGAAGAAGTCAAGAAGGACTGAAATCGA
ATTCCGGCCAAAGAACACCGGAAAGAGGAAACCCCTCCCCCAGGAAGTAGGGAAGAGAGTTATCTCAGGAAAAGTGACTAAGAGCATTCT
TGTCTCCTCACATAACAAACTATCTTGAAAGCAGTTATAACTAACATATACATCTATATAGCATTTTGCCAGCTATACCTAATATTTAAA
GCCCCCCTCTTCAAAAACAGAGTCCAGAAGCGATCAAACATATGCTTTAGTGCCTTTGATGCCTGAACTTGAG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53161)
Chromosome
8
Position
79.24 cM
Confidence
uncalculated
Protocol
unknown
Subscript
A

MQTL_1_Late_blight_8 MQTL_1_Maturity_8 MQTL_2_Late_blight_8
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53162)
Chromosome
9
Position
49.33 cM
Confidence
uncalculated
Protocol
unknown
Subscript
B

MQTL_1_Late_blight_9
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8944)
Chromosome
8
Position
16.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8945)
Chromosome
8
Position
7.80 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Potato-TXB 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8946)
Chromosome
9
Position
8.50 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG117 was used as an overgo probe on plate 12 [well E2]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P315C24,   P296K01,   P259B14,   P294A08,   P208F09,   P027O12,   P317F17

 Overgo Sequences

A sequence
CGGTCCTCTTTCTTAGTGGTTGAC
B sequence
GCCAATGAAAAACCCAGTCAACCA
AB sequence
CGGTCCTCTTTCTTAGTGGTTGACTGGGTT
Marker sequence
CTTTTGGTGGCACGTGAGTGTGTGTGGGCGGTCCTCTTTCTTAGTGGTTG
ACTGGGTTTTTCATTGGCAGGTGGGGGACCTCTTGTGATGTTTTCGCACA
ACATTCGAATGATACATCATCCTATAGAGTTTTCTGAAAATTGAAGCACA
TTGATTGTGTGGCTGTCTTTTCTTTCCCAGATATTTCTCACAATGTTCTG
ATACCATGTGAGAAGTAAAGACACGGAAAACATTATAAAAAATTGTATTT
ACATTATTACACTGAGCTCTATTTATAGTTATATTTTACATAATACATAA
TAATCCTATTTTAAGTGGGACACGATATACATTAATATTCTAACAGATCC
TATGTGAGTTCATGAATTTCTCTGGAGAAGATAAATATTATATTGCATTA
TCATCACGAAAAGAGCGGTATACAAATCTCAAATTGATTTTGGATTTCAT
CATAAAAACTGTAAAAAATAGACAACTTGGATCGATTTTTCATCAAGAA
Genomic location of TG117  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D348 marker 348
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)