SGN Marker TG30

SGN-M349

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2000
Vector
pUC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
TG30 image not available
Forward sequence
TTAAATATTGTTGCATTCGCGTGAAATTCTCAAAAATATACTTTCTTCGTGTCAATTATTTGTCTGTTTTAAGAAGAATGCCTCTTACTC
TTTAGTTTTAACTTTCCACGTAGCATATATGAAATTACAAGACTAAAATACATTTATTACATTCTACATATCTTTTTAGTTTAAGATTAC
AAGATTCAAAAGTTTGTTTTTTTCTCTTAAACTTTATGTTAAGACAGCTAGACAAACTAATTAAAACGAAAGGAGTATTATTTTTGAAAG
ATCCAATCTGTATGTATTTGACGATATTTTTGAAGATTCTGAACAGCGTACGTTAGTGGAAAGGAAGGAGAAACATAAGATATTTAGCAT
TCATCTTCTTTTTTTTTTTGGTTCTTATTCTTTGTTGATCTTGTGGTAGGCTATTAGTGGAATTTCAACCTCATCTTTATTATCTTGGGA
CATGGTTCTTGCACTTGTCTGTATGGGACATACCCTAAAGTGAAAAAACAGAATT
Reverse sequence
TTAAATATTGTTGCATTCGCGTGAAATTCTCAAAAATATACTTTCTTCGTGTCAATTATTTGTCTGTTTTAAGAAGAATGCCTCTTACTC
TTTAGTTTTAACTTTCCACGTAGCATATATGAAATTACAAGACTAAAATACATTTATTACATTCTACATATCTTTTTAGTTTAAGATTAC
AAGATTCAAAAGTTTGTTTTTTTCTCTTAAACTTTATGTTAAGACAGCTAGACAAACTAATTAAAACGAAAGGAGTATTATTTTTGAAAG
ATCCAATCTGTATGTATTTGACGATATTTTTGAAGATTCTGAACAGCGTACGTTAGTGGAAAGGAAGGAGAAACATAAGATATTTAGCAT
TCATCTTCTTTTTTTTTTTGGTTCTTATTCTTTGTTGATCTTGTGGTAGTCTATTAGTGGAATTTCAACCTCATCTTTATTATCTTGGGA
CATGGTTCTTGCACTTGTCTGTATGGGACATACCCTAAAGTGAAAAAACAGAATTTTTGTTAGTATTTAGTTTG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53855)
Chromosome
11
Position
10.70 cM
Confidence
uncalculated
Protocol
RFLP

Fruit_diameter_fd11_1 pH_pH11_1 Sugar_content_suc11_1 Fruit_weight_fw11_1 Lycopene_content_lyc11_1
Tomato QTL map

Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53534)
Chromosome
11
Position
100.72 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53259)
Chromosome
11
Position
42.36 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_11 MQTL_1_Maturity_11 MQTL_2_Late_blight_11 MQTL_2_Maturity_11
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8948)
Chromosome
11
Position
82.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8947)
Chromosome
11
Position
43.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG30 was used as an overgo probe on plate 10 [well A12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGGGACATGGTTCTTGCACTTGTC
B sequence
GGGTATGTCCCATACAGACAAGTG
AB sequence
TGGGACATGGTTCTTGCACTTGTCTGTATG
Marker sequence
TTAAATATTGTTGCATTCGCGTGAAATTCTCAAAAATATACTTTCTTCGT
GTCAATTATTTGTCTGTTTTAAGAAGAATGCCTCTTACTCTTTAGTTTTA
ACTTTCCACGTAGCATATATGAAATTACAAGACTAAAATACATTTATTAC
ATTCTACATATCTTTTTAGTTTAAGATTACAAGATTCAAAAGTTTGTTTT
TTTCTCTTAAACTTTATGTTAAGACAGCTAGACAAACTAATTAAAACGAA
AGGAGTATTATTTTTGAAAGATCCAATCTGTATGTATTTGACGATATTTT
TGAAGATTCTGAACAGCGTACGTTAGTGGAAAGGAAGGAGAAACATAAGA
TATTTAGCATTCATCTTCTTTTTTTTTTTGGTTCTTATTCTTTGTTGATC
TTGTGGTAGGCTATTAGTGGAATTTCAACCTCATCTTTATTATCTTGGGA
CATGGTTCTTGCACTTGTCTGTATGGGACATACCCTAAAGTGAAAAAACA
GAATT
Genomic location of TG30  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D349 marker 349
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)