SGN Marker TG251

SGN-M35

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CACACTGCTCGAATAGAAAAAATGGAAAAGCCTAAAAAGACGAGATCTTTATCTGTTCCTGATCTGGTGTTTGATCATGAAAGCAATCAT
GAGACCACAAAGACTAGCCCATACTCTTTGTGTTCCGTTTCATCATCGATATCATTATGGTACAGGAAATGGAAACTGAAAGATTTGTTT
CTATTCAGAAGTGCTTCTGAGGGTAGAGCAAGCAGTAAAGATCAATTAAACAAGTTTTTGAAGAAAACTTGTGAACAGGAGGAGGACGCG
AAGACTTCAAGCTTCAGATCAACTGCTAGTAGTGTTGCATCATCATCGGTATCAACCTCCTTGATGAGGAGGAGGGAGATTTCGGCTCAT
GAGTTGCACTACACGTTGAATATGGCATTCTCCGAAGAGATGAAGAGGAAGACATTTTTGCCATACAAGAAATTAGGGGTACTAGGTTGC
TTAGGATTCATTCCGTCAATGGATGATACACGTTTTAGAGGTGTAGCTCCATGTATGTCCATGAATCGTCGTCAATAACATCTCATTTTC
TCTTCAATTTG
Reverse sequence
AGATGTCGAGTTTTCAGACCATCAACTGACAAGAAAGCCAAACCAGAACCAATAATCCACAGGGTAACAATGCCTCACCATCACTCACTA
ACAGTCATACAGAGTTTAACCTCAGAACAACCTCAAGAGGATAAGAATTTTCCAACATTGAGAGAGAGATTGCATCATTTGAGTAAAACT
ATAAACCACCGAGTTTGTTTTGGAAAATCCGGTATACATGGATGGGGTCTCTTTGCTAAGAGAAAGCTTCAAGAAGGAGAAATGGTAGCT
GAGTATGTGGGTGAGAAGATAAGGGGCAGTGTCGCTGACCTTAGAGAGCGTAAATACAAGTCACAAGGCAAGAACTGTTACTTCTTCAGG
ATAACTGAAGAAGTAGTGATTGATGCAACCATGAAAGGATCCATAGCAAGATTAATCAACCACTCATGCATGCCAAATTGCTTTGCAAGG
ATCATGAGTCTTGGAGAAAACGAGGAACGAATTGTTCTTTTTGCTAAAAAGGATGTTTCAGCAGGGAATGAGTTAACCTTTGATTACAGA
TTTGAACCTGATCAGAATGATGAGGTTAAAGTCCCCTGTCACTGTGGAGCTCCCAACTGTAGCACATTCATGAATTAGAATAGCATAGGT
AGA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXHIR 1997   
Map version
32 (location: 7819)
Chromosome
3
Position
60.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7820)
Chromosome
3
Position
69.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG251 was used as an overgo probe on plate 4 [well D3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTTGCATCATCATCGGTATCAACC
B sequence
TCCTCCTCATCAAGGAGGTTGATA
AB sequence
GTTGCATCATCATCGGTATCAACCTCCTTG
Marker sequence
CACACTGCTCGAATAGAAAAAATGGAAAAGCCTAAAAAGACGAGATCTTT
ATCTGTTCCTGATCTGGTGTTTGATCATGAAAGCAATCATGAGACCACAA
AGACTAGCCCATACTCTTTGTGTTCCGTTTCATCATCGATATCATTATGG
TACAGGAAATGGAAACTGAAAGATTTGTTTCTATTCAGAAGTGCTTCTGA
GGGTAGAGCAAGCAGTAAAGATCAATTAAACAAGTTTTTGAAGAAAACTT
GTGAACAGGAGGAGGACGCGAAGACTTCAAGCTTCAGATCAACTGCTAGT
AGTGTTGCATCATCATCGGTATCAACCTCCTTGATGAGGAGGAGGGAGAT
TTCGGCTCATGAGTTGCACTACACGTTGAATATGGCATTCTCCGAAGAGA
TGAAGAGGAAGACATTTTTGCCATACAAGAAATTAGGGGTACTAGGTTGC
TTAGGATTCATTCCGTCAATGGATGATACACGTTTTAGAGGTGTAGCTCC
ATGTATGTCCATGAATCGTCGTCAATAACATCTCATTTTCTCTTCAATTT
G
Genomic location of TG251  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D35 marker 35
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)