SGN Marker TG624

SGN-M350

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2000
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
GGGAGACAGCTTGCATGCCTGCAGCCAGACAGCACTATTAAACTTAAAAAAATAGCTGACGGACTCCACGTTATGTTGGAGGAAGCAAGT
CCAGAATATGTCGGAATTGACCAATTCAGCAATTGAATGCTCCAGACAAATTTCAAGGGTAGCTGTAACACAGAAACAACACTCAAATCT
TTCATCACATTCCATTCAATATCATAGAATTAGCACCAACTTTTATGAAAAAATAGGTGTACCACTTTGCTCATCCAACAATACGATAAC
ATAGTGAGCTTGCTCAACACTCCTATAAGTACAACTTCTTCTACCCTGACCCATAAGTAAGGGTACAACCACAAGATAACAGCTTCACCT
ATACTAATCTCTCCTACCAAAATTTAGGCATGACACAGATTGGCATCTACTTAATGCTGGCAATGACCCTTTTACTTCTTCTAAAAGAAC
AGTGAAGATTTGGTATTGTTTTAAAGAGGAGAAAAAATGAAATGACTGAATTAATAGCTAGAATTCTTAACAGAAGAATCAT
Reverse sequence
GGAGACAGCTTGCATGCCTGCANCAGACAGCACTATTAAACTTAAAAAAATAGCTGACGGACTCCACGTTATGTTGGAGGAAGCAAGTCC
AGAATATGTCGGAATTGACCAATTCAGCAATTGAATGCTCCAGACAAATTTCAAGGGTAGCTGTAACACAGAAACAACACTCAAATCTTT
CATCACATTCCATTCAATATCATAGAATTAGCACCAACTTTTATGAAAAAATAGGTGTACCACTTTGCTCATCCAACAATACGATAACAT
AGTGAGCTTGCTCAACACTCCTATAAGTACAACTTCTTCTACCCTGACCCATAAGTAAGGGTACAACCACAAGATAACAGCTTCACCTAT
ACTAATCTCTCCTACCAAAATTTAGGCATGACACAGATTGGCATCTACTTAATGCTGGCAATGACCCTTTTACTTCTTCTAAAAGAACAG
TGAAGATTTGGTATTGTTTTAAAGAGGAGAAAAAATGAAATGACTGAATTAATAGCTAGAATTCTTAACAGAAGAATCAT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40116)
Chromosome
8
Position
36.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8949)
Chromosome
8
Position
36.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG624 was used as an overgo probe on plate 12 [well C7]

Plausible BAC Matches:   P336I24

 Overgo Sequences

A sequence
CCACGTTATGTTGGAGGAAGCAAG
B sequence
TCCGACATATTCTGGACTTGCTTC
AB sequence
CCACGTTATGTTGGAGGAAGCAAGTCCAGA
Marker sequence
GGGAGACAGCTTGCATGCCTGCAGCCAGACAGCACTATTAAACTTAAAAA
AATAGCTGACGGACTCCACGTTATGTTGGAGGAAGCAAGTCCAGAATATG
TCGGAATTGACCAATTCAGCAATTGAATGCTCCAGACAAATTTCAAGGGT
AGCTGTAACACAGAAACAACACTCAAATCTTTCATCACATTCCATTCAAT
ATCATAGAATTAGCACCAACTTTTATGAAAAAATAGGTGTACCACTTTGC
TCATCCAACAATACGATAACATAGTGAGCTTGCTCAACACTCCTATAAGT
ACAACTTCTTCTACCCTGACCCATAAGTAAGGGTACAACCACAAGATAAC
AGCTTCACCTATACTAATCTCTCCTACCAAAATTTAGGCATGACACAGAT
TGGCATCTACTTAATGCTGGCAATGACCCTTTTACTTCTTCTAAAAGAAC
AGTGAAGATTTGGTATTGTTTTAAAGAGGAGAAAAAATGAAATGACTGAA
TTAATAGCTAGAATTCTTAACAGAAGAATCAT
Genomic location of TG624  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D350 marker 350
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)