SGN Marker TG33

SGN-M353

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2400
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AACCTGCAATTTCTGGAGTTACGTCGAAAATCTCAGAGCAGAATAATGCTAGGTACCTCAACCAGATGAGGCTTAGTATCTGTAGAGGGA
AACTATAAATCCTGATGTGTGTCAAGTCCAAGATTTTCAGTAATTTGAAATGAATAAGCTCTGATTGGAGAACAAAAGTTGAAAAAAAGC
CACCCAATGAGAAAATAGAGCAAGTTCGTTTCAAAAGATTGTTGTCATCATCATCTCTCCACTCATGATGTCCAGGGGTAAGAAGGGCCC
TATATAGACCATACGGAGATCCATGAATTTCGTCACCAGTCCAGCGCTTAAACGGCTGCATATTATGCCTACTGAGAGGTTGGCATACAG
AAGGAACATGATTTGGATCACAATCATTGATTTGAGCTTTCTTTACATCGGATTTTTCAAACAGAATGTCTTTTATAATGAAAAGGTTTC
CTCTTTGAATTTGTCTCAAGCACAAGTCGTATATTAGATCATGAACCTTACATGATATAATTTTTGTTTCATCTCGACTTTTGTTGCTGA
CATGAACTAGACATCTGT
Reverse sequence
CCTGCAATTTCTGGAGTTACGTCGAAAATCTCAGAGCAGAATAATGCTAGGTACCTCAACCAGATGAGGCTTAGTATCTGTAGAGGGAAA
CTATAAATCCTGATGTGTGTCAAGTCCAAGATTTTCAGTAATTTGAAATGAATAAGCTCTGATTGGAGAACAAAAGTTGAAAAAAAGCCA
CCCAATGAGAAAATAGAGCAAGTTCGTTTCAAAAGATTGTTGTCATCATCATCTCTCCACTCATGATGTCCAGGGGTAAGAAGGGCCCTA
TATAGACCATACGGAGATCCATGAATTTCGTCACCAGTCCAGCGCTTAAACGGCTGCATATTATGCCTACTGAGAGGTTGGCATACAGAA
GGAACATGATTTGGATCACAATCATTGATTTGAGCTTTCTTTACATCGGATTTTTCAAACAGAATGTCTTTTATAATGAAAAGGTTTCCT
CTTTGAATTTGTCTCAAGCACAAGTCGTATATTAGATCATGAACCTTACATGATATAATTTTTGTTTCATCTCGACTTTTGTTGCTGACA
T
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53272)
Chromosome
2
Position
41.86 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_2 MQTL_2_Late_blight_2 MQTL_3_Late_blight_2
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39999)
Chromosome
2
Position
0.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8955)
Chromosome
2
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG33 was used as an overgo probe on plate 16 [well E3]

Plausible BAC Matches:   P324E24,   P016C21,   P076F02,   P332L20,   P040F10,   P335O22,   P143N24,   P048F13,   P010N13

 Non-Plausible BAC matches

P288B07,   P252F09,   P314N23,   P320C10,   P291O11,   P202J10,   P289O15,   P258A04,   P027N22,   P335D15,   P264K19

 Overgo Sequences

A sequence
CAGAGCAGAATAATGCTAGGTACC
B sequence
AGCCTCATCTGGTTGAGGTACCTA
AB sequence
CAGAGCAGAATAATGCTAGGTACCTCAACC
Marker sequence
AACCTGCAATTTCTGGAGTTACGTCGAAAATCTCAGAGCAGAATAATGCT
AGGTACCTCAACCAGATGAGGCTTAGTATCTGTAGAGGGAAACTATAAAT
CCTGATGTGTGTCAAGTCCAAGATTTTCAGTAATTTGAAATGAATAAGCT
CTGATTGGAGAACAAAAGTTGAAAAAAAGCCACCCAATGAGAAAATAGAG
CAAGTTCGTTTCAAAAGATTGTTGTCATCATCATCTCTCCACTCATGATG
TCCAGGGGTAAGAAGGGCCCTATATAGACCATACGGAGATCCATGAATTT
CGTCACCAGTCCAGCGCTTAAACGGCTGCATATTATGCCTACTGAGAGGT
TGGCATACAGAAGGAACATGATTTGGATCACAATCATTGATTTGAGCTTT
CTTTACATCGGATTTTTCAAACAGAATGTCTTTTATAATGAAAAGGTTTC
CTCTTTGAATTTGTCTCAAGCACAAGTCGTATATTAGATCATGAACCTTA
CATGATATAATTTTTGTTTCATCTCGACTTTTGTTGCTGACATGAACTAG
ACATCTGT
Genomic location of TG33  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D353 marker 353
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)