SGN Marker TG481

SGN-M354

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2000
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CATCGGTTCATTTTGGTAGAGTTTCAGGTTTTGTATAGTTAGTTTGAGGGAACATTGATTTTCTTGGTGGTGGAAGGCTGGTAGAGTGGG
AAGGGATCTCTCAGTAATTGATTTGGAGTAGACTGACTAATGCACGATTCGTGGTATTCTTATGAGCGTTGCTTAGTTGTTGATACTGAA
TTTTGGAGTAGTTCCTTGTAGTTGTCTTTTCCTCGTACCACTTGATATATAACTGTTGAAATTTAGAACGAGCACAAATTAGTGCATAGC
ATCTATTTTTGGATGATATACAACATAGCTAAAGTGATACAAAAAATATATCATGTTTTAGTAATTTTCCCTATTTAAACCAGTCACCAT
GTTACATCACCCAAATGGAAGAATACGCAGCTCTAATACTGGATTCTGAGGGAATTACTTTGCAAACCTAAATTTTTCATTCCCTAAATA
TTTCATATTCGAATTCTGCAACTTGCTAAATGCATATTTGCTGATGAATATT
Reverse sequence
GGGAGACAAGCTTGCATGCCTGCAGTGCGAGTACCAATATATATAGAATGTCACAATCACAAAGAATTTCATGTGACGAGCATAATGATA
ACATATCTACAGGCTTCACAATGTATTTAGAAAAGAACTACTTCAGTTGAAGTATATCATGCTAGAAATTTGATTCATTGCCAATAAGTA
TAATTCAGTCACCAATATCAAATAACTATGTTTGAACTCCAAATATCAATCTACTATATGCAATCGCATTACAATATAGGCCTAAATTGT
GGACTTACATTCAGACTATCGGGAGACATACAGCAAGTAAAATCTAAGAACGCGTCTAGTGTTAAAGAATCCCAATTATGAAGAATTGGA
ATAAAACAGGCATGGATTCATGGAACTGACTCTAATTAGCTTGGAATTGAAGCTTAGTAGTTTTACTGAGCTCACTGAATAACACAAACC
AACACATCCAAAAAGAAACAAATAAAAAAGGCGACAATATTTAAAAACCTGCAAAAGGCTGCAATAATTGTCCCACGAA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8958)
Chromosome
8
Position
34.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG481 was used as an overgo probe on plate 12 [well G1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATTTTCTTGGTGGTGGAAGGCTGG
B sequence
ATCCCTTCCCACTCTACCAGCCTT
AB sequence
ATTTTCTTGGTGGTGGAAGGCTGGTAGAGT
Marker sequence
CATCGGTTCATTTTGGTAGAGTTTCAGGTTTTGTATAGTTAGTTTGAGGG
AACATTGATTTTCTTGGTGGTGGAAGGCTGGTAGAGTGGGAAGGGATCTC
TCAGTAATTGATTTGGAGTAGACTGACTAATGCACGATTCGTGGTATTCT
TATGAGCGTTGCTTAGTTGTTGATACTGAATTTTGGAGTAGTTCCTTGTA
GTTGTCTTTTCCTCGTACCACTTGATATATAACTGTTGAAATTTAGAACG
AGCACAAATTAGTGCATAGCATCTATTTTTGGATGATATACAACATAGCT
AAAGTGATACAAAAAATATATCATGTTTTAGTAATTTTCCCTATTTAAAC
CAGTCACCATGTTACATCACCCAAATGGAAGAATACGCAGCTCTAATACT
GGATTCTGAGGGAATTACTTTGCAAACCTAAATTTTTCATTCCCTAAATA
TTTCATATTCGAATTCTGCAACTTGCTAAATGCATATTTGCTGATGAATA
TT
Genomic location of TG481  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D354 marker 354
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)