SGN Marker TG557

SGN-M357

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1700
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CCAAACAAGGGTCCTTCTGATGCACTTAACTTTGAGTTTACTGACACTAATGATGAGATTTTTTGTGTTAGTTGTTGCTGTCATATTTTG
CAAATAAAGTGTGTAGTGGTGGATGACTGCACTTTCCGTTACTGCTGTGGTGCTGCTGTGCGGGCAGCATTGAGTCTTTGCGGTCCAGCT
GGATCTTTGGGTTTTGCTTATGCCATTACTGTTTTACGGTCCAGCTGATCCTAAGAGTTTTGCCTACGTCATTGGTGTTGTCCTGTTTAT
TTCTCCACGTATATACTTATGGCCTGTACCCATCAAATAAATCAGGGAAGAGAAAGGTCTAAAGTCTTCACCAACAAATAGAAAAACACG
TCTAGAGATGAATCAACTCCAGTTTATAGCTGTCAGCTAGAGATTAATATTGGCGACATTTCTTAGATGCTTATCTAATTAATGTAACTT
TTCTCCATTACAGATCCCTGAAGAGGAGAAAAACCTGAGTCCTCTTGATC
Reverse sequence
AGCTTGCATGCCTGCAGTACCAATATGAGCCAATTATACACGAATTAATATGAAGTATTATCACTTGTGAATTAGCAGTACTGCATTATT
AAACTAGCTTTGGGTTAGCTTATTTAATAAAATGTTTTGATTTTTAACCTGAAAGGTAAGCCAAACTATACGTTCCTGAATCGCCAAAGA
GACAAACCAGTGTCTCTGTGGTAGGATTTCAATACAAAAGAGACACTGAGCGCACAGGTAAAAGATCAAGACAAGCCAATTTCAGGCAAC
CAAGAATCACCAGCCATGAAGTAGTCTTATAAAGTAAATATATATAACAATGTATTCAGGTTCATTAGCATGTTGAAAGCTAGAGCAAGG
GTTGCGTTAAATTGACAGATGGGGCTGATTGTTGCTCAACTAGCGTCAAAAGATATCTCAGAGAAAAGGACCTCAAAAGAAAATTAGCTG
TTATATTTTTGTATTTCAATGATTTAAGACTTGTTGGTCCACTTGGATGGTTGCCTTATACACTAATCATCACCAGCATAACGGAAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1485999.6e-1239 (7.8% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40086)
Chromosome
11
Position
4.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Pepper-AC99   
Map version
34 (location: 8971)
Chromosome
12
Position
41.43 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8967)
Chromosome
11
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8968)
Chromosome
11
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG557 was used as an overgo probe on plate 9 [well G9]

Plausible BAC Matches:   P118O03

 Overgo Sequences

A sequence
AGTGTGTAGTGGTGGATGACTGCA
B sequence
CAGCAGTAACGGAAAGTGCAGTCA
AB sequence
AGTGTGTAGTGGTGGATGACTGCACTTTCC
Marker sequence
CCAAACAAGGGTCCTTCTGATGCACTTAACTTTGAGTTTACTGACACTAA
TGATGAGATTTTTTGTGTTAGTTGTTGCTGTCATATTTTGCAAATAAAGT
GTGTAGTGGTGGATGACTGCACTTTCCGTTACTGCTGTGGTGCTGCTGTG
CGGGCAGCATTGAGTCTTTGCGGTCCAGCTGGATCTTTGGGTTTTGCTTA
TGCCATTACTGTTTTACGGTCCAGCTGATCCTAAGAGTTTTGCCTACGTC
ATTGGTGTTGTCCTGTTTATTTCTCCACGTATATACTTATGGCCTGTACC
CATCAAATAAATCAGGGAAGAGAAAGGTCTAAAGTCTTCACCAACAAATA
GAAAAACACGTCTAGAGATGAATCAACTCCAGTTTATAGCTGTCAGCTAG
AGATTAATATTGGCGACATTTCTTAGATGCTTATCTAATTAATGTAACTT
TTCTCCATTACAGATCCCTGAAGAGGAGAAAAACCTGAGTCCTCTTGATC
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG557  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D357 marker 357
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)