Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker TG558

SGN-M358

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
950
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AATGAAGTTCAGTTGATAAGCTAAATGGTGGAAATACTAATTTTAATTGACAGTAACTTTGCATTTCAAGGTCCATACCAAAACATTTGC
TAACACCAGTTGCTTTGTCAACGAAAACCTTGGCACTCAAAACCCTACCAAAAGGCTGAAATGCATTTGCAAGCTCTTGATCACCAAATT
CTTGAGGAATATGGTAAATAAATAGATTAGCACCAGGTGGACCTGTAAACAGCAAAATCGTTTTTGATAAGTACAGGTTTATTTCTACAT
GTTCAACTACCACTGCCAAGTACACTAGTTCAAGTGACATCTCCACCACTTAATTGCATAAAGCTTTACCAACGACAAATATAACAAACT
TGTGCAAGTAATTTGAGTTCCTGTCTATACAGTCCAGAATCTCCATATGCTGCTCATCTCACAATGTTGGTTAAGGAAATTTGTCAAGTA
AAGTTCAAATCAACATGCTGTAAGACTATACTTGCTG
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGCATCTTCAAGTGTCAGTTCAAGTACAGGGGGTCAGGTTGAAGGTTGTTGAACATTTATTTTGTGACC
TTTTTAGCTCTAGAATTTCTGTAGCTAATCAAGTACAGTCCCATAACCTAGGGGCTGTTAGGGTTTTCTGCTGAATGAGGCTGCTTGTCT
TTATTTTGGTTAATTATTTTCTGGAAATTGTTCCTCGTCATAGAGAATAGAAGTAGAAGAAGAAGAAGATAGTATAATCTATTATATTTG
TTTTTTACTTAATTTATAAAGATTCCATAAATGCATGTGATCTTTGATCAATGATATCTTATACAAGTGTATCACTAGAATCTATTATAT
TTGGATTTACTTATTTTATATAGGATTTCATAAACGCATGTGATCTCTGACTAATGATATCTAATACATGTGTGTCATAGCAAGTATCAA
AAAGGCTATGTAGCTATTCCTAAGTGTTGCAGCAAGTATAGTCTTACAGCATGTTGATTTGAACTTTACTTGACAAATTTCCTTAACCAA
CATTGT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8972)
Chromosome
9
Position
63.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG558 was used as an overgo probe on plate 15 [well H1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCTAACACCAGTTGCTTTGTCAAC
B sequence
GAGTGCCAAGGTTTTCGTTGACAA
AB sequence
GCTAACACCAGTTGCTTTGTCAACGAAAAC
Marker sequence
AATGAAGTTCAGTTGATAAGCTAAATGGTGGAAATACTAATTTTAATTGA
CAGTAACTTTGCATTTCAAGGTCCATACCAAAACATTTGCTAACACCAGT
TGCTTTGTCAACGAAAACCTTGGCACTCAAAACCCTACCAAAAGGCTGAA
ATGCATTTGCAAGCTCTTGATCACCAAATTCTTGAGGAATATGGTAAATA
AATAGATTAGCACCAGGTGGACCTGTAAACAGCAAAATCGTTTTTGATAA
GTACAGGTTTATTTCTACATGTTCAACTACCACTGCCAAGTACACTAGTT
CAAGTGACATCTCCACCACTTAATTGCATAAAGCTTTACCAACGACAAAT
ATAACAAACTTGTGCAAGTAATTTGAGTTCCTGTCTATACAGTCCAGAAT
CTCCATATGCTGCTCATCTCACAATGTTGGTTAAGGAAATTTGTCAAGTA
AAGTTCAAATCAACATGCTGTAAGACTATACTTGCTG
Genomic location of TG558  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D358 marker 358
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)