SGN Marker TG237

SGN-M36

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2100
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG237 image not available
Forward sequence
TTTACAACGCCTGATGATTTGCTTCTTGCAGAAAGAATATTGAATATTGAAGAATCTTAGGGTTTTCAATTTTCTTAGGCTTTTTTTTTG
TTCAAACATTATAATTCCCTGGAAATTTGTATTCTGAATAGGTGAAGTTAACCTTCCACAAGAGTTCCTCAGAAAATTGAGTCTTGTAAA
CTTATTGGCAAAAGAAAGCAACATTCTTTTCAAGGTTTTCAGCTCATGACTGAGACTTTGACAAAAGCGTGCATAAGATGAAAATTGGCT
TGTTATGAAGTTATAAACTTGCAGAAATATTTTTAGTTTTAAAGTGGAAAACAGTGAATAAAAAAAAATTTCTATTTGGCACCAATAGAA
ATGCTAAAATTACAGGTGTACTTTTGTTCTTGGGGCTTTATTTTACCTTCTTAAAGGATAAAAATTACTAGAGAAATCTGAATTATTAGT
GCAACAGTCAATAAGGCTTGGAAAGAAGGTAATAAAGATGTACTCAATAGCAAGAGAAAAATGTTTCCTAAATGACCTTTTATTAATTTC
ATTGAA
Reverse sequence
ATCAAGAAGTAGCTTTAATGATCCTGAAAGCAAGATGGTTGAAACTTTTGAGTCAGCAAGTGGAAATGCTGGAACGAGTAGTTCTAAAGA
GAGAATCTCAGAAATTCCAGTGCAGAGAATAGAATCCATCATACGTGAGCAGAGGTTAGAAACAGCATGGTTACAAGCAATGGAGAAAGG
CACTCCTGGATCAATGAGTCGCCTGAAACCTGAGAGGAACCAAGTCCTGCCACAAGATGGTCTTTATCATAACAACCAACTAGAACCAAT
TAATTCAAGGGAACTGTTCTCCCAGCATTGGCATGATGATCTAAATGAGGAAATTAGAAGTCTGAAGATGATTGACGGAAAGGCTGTTCA
GAAGGATCAAACCAGTAAAAAGGGCGACAGTTATCCCATTTCACCAAGTTTGTTGCATAATGGCATATATGGCAGTAATTTCAGCAAAGA
GAGCATGTAAGTTCTTGCACTTATCTGTTCATAAGTTATCTCAGTATACACTAAGTTAACATATGTCAACACTTACATAACACAGTATAC
TTCTCCTGATGCAATGACAACTTTTTGTGGCTTGCTTTAGATGTAGATGAG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1481497e-121245 (44.9% of RFLP seq)+
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53229)
Chromosome
1
Position
90.68 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_1 MQTL_2_Late_blight_1
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7821)
Chromosome
1
Position
93.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 7822)
Chromosome
1
Position
56.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG237 was used as an overgo probe on plate 5 [well H3]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P295N06,   P054O24,   P277E13

 Overgo Sequences

A sequence
AGGTTTTCAGCTCATGACTGAGAC
B sequence
GCACGCTTTTGTCAAAGTCTCAGT
AB sequence
AGGTTTTCAGCTCATGACTGAGACTTTGAC
Marker sequence
TTTACAACGCCTGATGATTTGCTTCTTGCAGAAAGAATATTGAATATTGA
AGAATCTTAGGGTTTTCAATTTTCTTAGGCTTTTTTTTTGTTCAAACATT
ATAATTCCCTGGAAATTTGTATTCTGAATAGGTGAAGTTAACCTTCCACA
AGAGTTCCTCAGAAAATTGAGTCTTGTAAACTTATTGGCAAAAGAAAGCA
ACATTCTTTTCAAGGTTTTCAGCTCATGACTGAGACTTTGACAAAAGCGT
GCATAAGATGAAAATTGGCTTGTTATGAAGTTATAAACTTGCAGAAATAT
TTTTAGTTTTAAAGTGGAAAACAGTGAATAAAAAAAAATTTCTATTTGGC
ACCAATAGAAATGCTAAAATTACAGGTGTACTTTTGTTCTTGGGGCTTTA
TTTTACCTTCTTAAAGGATAAAAATTACTAGAGAAATCTGAATTATTAGT
GCAACAGTCAATAAGGCTTGGAAAGAAGGTAATAAAGATGTACTCAATAG
CAAGAGAAAAATGTTTCCTAAATGACCTTTTATTAATTTCATTGAA
Genomic location of TG237  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D36 marker 36
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)