SGN Marker TG38

SGN-M362

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2300
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
TG38 image not available
Forward sequence
ATTCATTTGAGCTGCATTTATTATATATACCCAGAAAATAAAAATAAACTCTTGATTTCAAAATTCTATAGAACTAGGATAAAAACAAAC
AAACACATGAGTTATGTTAACAATGAAGAAAAAAAAGAGAGAAATTGAAGATGAATTAACCTGAGGGTGAAACTTTTTGATTTATGAAGT
GCTCCTAAATGGCTAATCCAATTGTATTTTAATTAAATAAATTGGGAATGAAGTTGTGATTGACACCACATAGAGTAGAAAGAATAAATT
CCACAAAAGAAAATAAGTAGTACTAATACTTAACAATCTTTCCGCGCGTTGAATTGTTTATTATGTTTTGATTATCACATTATTTTATTA
TTAATTTTGGCTTTTTGTTGTTAGATTTTGCTTCATGTATTGTTCATTTTTACTATATTTTAATTATCACATTATTTTATTATATTAATT
TCGAATTCTTATTATTAAATTGTATTTGAGCTAAAAATGTCTTTCAAAAACAATATCATTTTTATAAAATAATGAGCATATTATTATTAT
TATTATGGGTGAGAAAAA
Reverse sequence
ATTCATTTGAGCTGCATTTATTATATATACCCAGAAAATAAAAATAAACTCTTGATTTCAAAATTCTATAGAACTAGGATAAAAACAAAC
AAACACATGAGTTATGTTAACAATGAAGAAAAAAAAGAGAGAAATTGAAGATGAATTAACCTGAGGGTGAAACTTTTTGATTTATGAAGT
GCTCCTAAATGGCTAATCCAATTGTATTTTAATTAAATAAATTGGGAATGAAGTTGTGATTGACACCACATAGAGTAGAAAGAATAAATT
CCACAAAAGAAAATAAGTAGTACTAATACTTAACAATCTTTCCGCGCGTTGAATTGTTTATTATGTTTTGATTATCACATTATTTTATTA
TTAATTTTGGCTTTTTGTTGTTAGATTTTGCTTCATGTATTGTTCATTTTTACTATATTTTAATTATCACATTATTTTATTATATTAATT
TCGAATTCTTATTATTAAATTGTATTTGAGCTAAAAATGTCTTTCAAAAACAATATCATTTTTATAAAATAATGAGTATATTATTATTAT
TATTATGGTTGAGAAAAA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8976)
Chromosome
1
Position
100.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8977)
Chromosome
12
Position
42.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG38 was used as an overgo probe on plate 5 [well C7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGGGAATGAAGTTGTGATTGACAC
B sequence
CTTTCTACTCTATGTGGTGTCAAT
AB sequence
TGGGAATGAAGTTGTGATTGACACCACATA
Marker sequence
ATTCATTTGAGCTGCATTTATTATATATACCCAGAAAATAAAAATAAACT
CTTGATTTCAAAATTCTATAGAACTAGGATAAAAACAAACAAACACATGA
GTTATGTTAACAATGAAGAAAAAAAAGAGAGAAATTGAAGATGAATTAAC
CTGAGGGTGAAACTTTTTGATTTATGAAGTGCTCCTAAATGGCTAATCCA
ATTGTATTTTAATTAAATAAATTGGGAATGAAGTTGTGATTGACACCACA
TAGAGTAGAAAGAATAAATTCCACAAAAGAAAATAAGTAGTACTAATACT
TAACAATCTTTCCGCGCGTTGAATTGTTTATTATGTTTTGATTATCACAT
TATTTTATTATTAATTTTGGCTTTTTGTTGTTAGATTTTGCTTCATGTAT
TGTTCATTTTTACTATATTTTAATTATCACATTATTTTATTATATTAATT
TCGAATTCTTATTATTAAATTGTATTTGAGCTAAAAATGTCTTTCAAAAA
CAATATCATTTTTATAAAATAATGAGCATATTATTATTATTATTATGGGT
GAGAAAAA
Genomic location of TG38  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D362 marker 362
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)