SGN Marker TG39

SGN-M363

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2600
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
TG39 image not available
Forward sequence
GCTGGGCTGAGACTTGTGTCCACGTTCAGAAAATTAAATAAGTACTGTGGATCTCTTGATTGTGGGAAAAGCATATTTTAACAGCGGCTG
TTGGAATTTGAACACAAATCTGGAAACCTCAAACCAAATTTCTGATCTTCTGTTTCTTTTGTTCAGAGAAAATTCAAAGTGGCAAAAACC
AAGTGTCTATGTATATCAGCAATCTAGGATTAATGTAGCAGCTCAACATTTGTCAATGAAAGCATCCACAAGCTTGAAATGATCTACATT
TCTCAAAAGACGGGTGCAAAATAAACCAGGGTACAGGTTCTGTTAAAAGAAGGGATCAACAGAACAACTGACATCAGAAACTAACTTTCA
ATACAGCCACATAACTCTTGAGCTAGAACCCCCACACACAAAGTAAACCTTTAATTTTTGTGCGCCACATTTGGCGTTGAGGAAACTAAT
CTAGCACAGTGTGGTATCTTGACAAGCCCAGACTAGACATTACCAGCATATGATCTACGTTAGAGTTCAAACAGAGCTACTGTTGTAGTA
AAGAATACTTTTTAGAGGAGTAGGTTTCTTAGATAGATTT
Reverse sequence
CTGGGCTGCGACTTGTGTCCCCGTTCAGAAAATTAAATAAGTACTGTGGATCTCTTGATTGTGGGAAAAGCATATTTTAACAGCGGCTGT
TGGAATTTGAACACAAATCTGGAAACCTCAAACCAAATTTCTGATCTTCTGTTTCTTTTGTTCAGAGAAAATTCAAAGTGGCAAAAACCA
AGTGTCTATGTATATCAGCAATCTAGGATTAATGTAGCAGCTCAACATTTGTCAATGAAAGCATCCACAAGCTTGAAATGATCTACATTT
CTCAAAAGACGGGTGCAAAATAAACCAGGGTACAGGTTCTGTTAAAAGAAGGGATCAACAGAACAACTGACATCAGAAACTAACTTTCAA
TACAGCCACATAACTCTTGAGCTAGAACCCCCACACACAAAGTAAACCTTTAATTTTTGTGCGCCACATTTGGCGTTGAGGAAACTAATC
TAGCACAGTGTGGTATCTTGACAAGCCCAGACTAGACATTACCAGCATATGATCTACGTTAGAGTTCAAACAGAGCTACTGTTGTAGTAA
AGAATACTTTTTAGAGGAGTAG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8978)
Chromosome
3
Position
58.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG39 was used as an overgo probe on plate 14 [well C3]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P193E21,   P329E19,   P305G02,   P189C13,   P278F12,   P317M22,   P305E10

 Overgo Sequences

A sequence
TCTAGCACAGTGTGGTATCTTGAC
B sequence
TGTCTAGTCTGGGCTTGTCAAGAT
AB sequence
TCTAGCACAGTGTGGTATCTTGACAAGCCC
Marker sequence
GCTGGGCTGAGACTTGTGTCCACGTTCAGAAAATTAAATAAGTACTGTGG
ATCTCTTGATTGTGGGAAAAGCATATTTTAACAGCGGCTGTTGGAATTTG
AACACAAATCTGGAAACCTCAAACCAAATTTCTGATCTTCTGTTTCTTTT
GTTCAGAGAAAATTCAAAGTGGCAAAAACCAAGTGTCTATGTATATCAGC
AATCTAGGATTAATGTAGCAGCTCAACATTTGTCAATGAAAGCATCCACA
AGCTTGAAATGATCTACATTTCTCAAAAGACGGGTGCAAAATAAACCAGG
GTACAGGTTCTGTTAAAAGAAGGGATCAACAGAACAACTGACATCAGAAA
CTAACTTTCAATACAGCCACATAACTCTTGAGCTAGAACCCCCACACACA
AAGTAAACCTTTAATTTTTGTGCGCCACATTTGGCGTTGAGGAAACTAAT
CTAGCACAGTGTGGTATCTTGACAAGCCCAGACTAGACATTACCAGCATA
TGATCTACGTTAGAGTTCAAACAGAGCTACTGTTGTAGTAAAGAATACTT
TTTAGAGGAGTAGGTTTCTTAGATAGATTT
Genomic location of TG39  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D363 marker 363
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)