SGN Marker TG489

SGN-M364

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG489 image not available
Forward sequence
TAGATAAAGTAACCTGCCTTGATTTGAAAAGCGGCTATTATCCTGTCCATCCTCAGCTTTGGACAGAATCTGCATTTGAAAGCTTTGGCA
TTATTCTAACTTGAAATGTGATTGCGGAGATGGGATGATGATGGTGATTAGTGAGTAAAATACAGTGTGAGCTCCATGTATTGACAAAAG
GGCAGAAAGAATATGACATGATCATGAAGAACACTGTATAAATTATAAAGAGATTCACTCCAGAAGGATTTTTCCACCACACTCCAAGAG
GATTACTCCAGCACTTTATCAAATATATGTCAGGTTTCCAACAATAAAGGCACAAAGAATGTTTTGTGACGATATCCAATTAAGGTATGG
ATAACCAATGGCTATCGAAACAACTTTCTGAAGTTTTGACTAAAAATTCACACATGACAAAGCCACTGCACATACATGAGTTTTAACTAT
CTAAT
Reverse sequence
AGGGAGACAGCTTGCATGCCTGCAGTTTTGAGAGGATGGTAGTTTTAGACTTGGGTAAGGGAGAGATAGGACGGTAGTTTTTCTAGTTTT
ATACTAGAACTAAGGCACATTGCTTATTCAGAGGTTAGAGATAGCAGTTTTTCTAGTTTTATACTAGAACTAAGGCACATTGCTTAGTCA
GAGGTTAGAGATAGCATTGTTCCTGACTTCTAAAAGCCTACAGATCCCCTTTACAACATTCCTTGCTCATGATAAATCAGATAAAACTGC
AAATATGCTTCTCTCCAAATACTGAGTTATTTTGTAAACCGAAGGAACAGATATATAGTTATTTAAATTGTTTCCAATATGCTGAAGAAA
CCTCTTCATCTTGTTCATTTCTATAAATTTATGTGGCAAAGTTTCTTATAGTCTGGCACTTAGTTTTGGGTTGAACGGGTTAGCTGTATC
TATGTCCTGATCAGAGTGCGTGCAAGGTTGGATGGTTTCGGAATG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8979)
Chromosome
1
Position
63.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG489 was used as an overgo probe on plate 5 [well F10]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
AAAGCGGCTATTATCCTGTCCATC
B sequence
TCTGTCCAAAGCTGAGGATGGACA
AB sequence
AAAGCGGCTATTATCCTGTCCATCCTCAGC
Marker sequence
TAGATAAAGTAACCTGCCTTGATTTGAAAAGCGGCTATTATCCTGTCCAT
CCTCAGCTTTGGACAGAATCTGCATTTGAAAGCTTTGGCATTATTCTAAC
TTGAAATGTGATTGCGGAGATGGGATGATGATGGTGATTAGTGAGTAAAA
TACAGTGTGAGCTCCATGTATTGACAAAAGGGCAGAAAGAATATGACATG
ATCATGAAGAACACTGTATAAATTATAAAGAGATTCACTCCAGAAGGATT
TTTCCACCACACTCCAAGAGGATTACTCCAGCACTTTATCAAATATATGT
CAGGTTTCCAACAATAAAGGCACAAAGAATGTTTTGTGACGATATCCAAT
TAAGGTATGGATAACCAATGGCTATCGAAACAACTTTCTGAAGTTTTGAC
TAAAAATTCACACATGACAAAGCCACTGCACATACATGAGTTTTAACTAT
CTAAT
Genomic location of TG489  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D364 marker 364
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)