SGN Marker TG121

SGN-M365

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
3400
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
TG121 image not available
Forward sequence
GGGGATCCTCAGAGTCGACCTCCANTAGACGAAACATGCAGTTGAGTAGGCAGAATGTGATGTCAAACGGAAAATTGAATTAAAGCTGAG
ATACATGTGGGACTTCAGTTCTTAAAAGGCACTAGGATCATCAAGCATCGTGTTCGGAAGGTCACATAAACGCCATTTAAGCAACAAGTA
TTATATAGTATAAAACCAGTAATGTTATATGAGAGTGAATGTGGGCTGCTAGAGTTCCATCGTATCGACAAGATGAGAGTTGCAGAGATG
TAGATACTAAGATGAATGTGCCGGTCATACAAGAACAAGATTGGACATTAACCATTTAGCTTTTTCGTAGAATGACTTTGATGAACATGC
TTCATGGAAAAACACAAAACGGAAATCACCTAATGCCCAAGAGAAACAAACTCAGACATTTTAATAGGATTGCACGAAGAACCATAAGAA
ACCTCTACATTCAGCCTCATCAGAACA
Reverse sequence
TCTTTTACTGTTGACTAGGGTACTATAGCTAAATCAACCAATTCTTTTGACAATAACCCCATGCGGATATCTTTCAGCCTACTTTGCCTC
ATTGACTCCAGAGTGATCCTGGCATATCCAAGTTCTTCCAGTACTTGTCTCCTTGTTTGTTAAGTGTTTCTGAACTTGTATCTGTATTTA
GTTCCAACAATCCCCCCCCCCCCCCCACACACACACCCCAAATTTGTTTCTTAATAGGCATGAATTTTTGGAATGCATAAACGATGCACA
TTGTTGTTATTTTAGTATCTATCTTTGAGGACCTATAAAGTATTTAGATTAAATGATGCAATGTACTGGCTTTTTGCAGGCAGACAAGGT
GACCGTCATATTTCCTATGAGATTCAATGATTCCATAGATACTGTTCTAGCAACATCTTTCTTACAGGTAAACTTCTACACGTTTTAATG
TGTTCTTGTCCTT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1538661.2e-3282 (17.7% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8980)
Chromosome
11
Position
77.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG121 was used as an overgo probe on plate 10 [well B9]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P315O19,   P118P14,   P244K02,   P219N22

 Overgo Sequences

A sequence
AGGCACTAGGATCATCAAGCATCG
B sequence
TGTGACCTTCCGAACACGATGCTT
AB sequence
AGGCACTAGGATCATCAAGCATCGTGTTCG
Marker sequence
GGGGATCCTCAGAGTCGACCTCCANTAGACGAAACATGCAGTTGAGTAGG
CAGAATGTGATGTCAAACGGAAAATTGAATTAAAGCTGAGATACATGTGG
GACTTCAGTTCTTAAAAGGCACTAGGATCATCAAGCATCGTGTTCGGAAG
GTCACATAAACGCCATTTAAGCAACAAGTATTATATAGTATAAAACCAGT
AATGTTATATGAGAGTGAATGTGGGCTGCTAGAGTTCCATCGTATCGACA
AGATGAGAGTTGCAGAGATGTAGATACTAAGATGAATGTGCCGGTCATAC
AAGAACAAGATTGGACATTAACCATTTAGCTTTTTCGTAGAATGACTTTG
ATGAACATGCTTCATGGAAAAACACAAAACGGAAATCACCTAATGCCCAA
GAGAAACAAACTCAGACATTTTAATAGGATTGCACGAAGAACCATAAGAA
ACCTCTACATTCAGCCTCATCAGAACA
Genomic location of TG121  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D365 marker 365
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)