SGN Marker TG122

SGN-M366

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
3200
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CTTATTTCAACTCTCTGACAAATGATTTCACCAAGAGGAAACTGGTTAACACGATAGATCAAGTTACAACATCTGATTTTCAGGGCACTG
TTATGCCTTCCAAAAAAACAATTCAATGAAACATTGTGGCATAATTATGAGAATCTCCTAGTGATTTTCTTTTGATAACCAGAAACCTTC
AAGGTCAATGGCACACAGCTTGGAACTCAGCGGATAAGGGACCCATCCATGCAACCCTCTCCATTTATATACTAAGAGAATCTCCTAATG
AATTGAAGATGACGAATAAGTAATCACCTGGTTTGAGTGGAGATCAAATATCCCCAACCTATTAAGAGTGCCTATCTCCACAGGTAATGA
AGTAAGTGCATTATTCCTGTCAAAGTGGATAAAGAAAAGAATGGGGCCGCGGTGGAGAGGGAAAATGTGAATGTAACGAA
Reverse sequence
AAGCTGATTCTGGCTCCATGACTAGAACATTGCAGGAAGACATTCGAAATTTACCTCTACTGCAGTGCTAAATGTTAGTCACAACAAGCT
AACCCATCTTCCATCTGCTATTGGAGAGTATGTCCTTTTTTTACCTCTTCAATCTTGAAATACTTTATTCTGGTTCTTTTTTAGCATCTT
ACATGAAAGCTGATCCAGAGATTTAATGACTTCTCTTTTATTCTGCTAGGCTTCATATGCTGAAGTCGTTAGATGTATCATTTAACTTGA
TAGTGAATATTCCAGAAGAGATCGGAACAGCAGCTTCTCTAGTCAAGTAGGTTTGATCATTTCACCACTGTATTAAATAACATTTGACCC
ACTACCAGCTTATTAAATATCTGTGTACTGACTCCAGGCTTGATTGTTCAAACAACCAACTAAATGATCTCCCTAACTCCCTTGGAAGAT
GTGTGGAGTTATCA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1548277.1e-3167 (14.4% of RFLP seq)-
SGN-U1548273.3e-4294 (20.3% of RFLP seq)-
SGN-U1548272.1e-4388 (19.0% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53165)
Chromosome
10
Position
40.57 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_10 MQTL_2_Late_blight_10
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43828)
Chromosome
10
Position
5.50 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43579)
Chromosome
10
Position
5.90 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43288)
Chromosome
10
Position
6.00 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40830)
Chromosome
10
Position
0.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36571
Forward primer (5'-3')
AGCTTGGAACTCAGCGGATA
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
CCCTTGGAAGATGTGTGGAG
Digested band sizes (using EcoRI)
Solanum lycopersicum TA209
1600
Solanum pennellii TA56
3000
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8981)
Chromosome
10
Position
2.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8983)
Chromosome
10
Position
1.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8982)
Chromosome
10
Position
0.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG122 was used as an overgo probe on plate 14 [well D8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCAGAAACCTTCAAGGTCAATGGC
B sequence
GAGTTCCAAGCTGTGTGCCATTGA
AB sequence
CCAGAAACCTTCAAGGTCAATGGCACACAG
Marker sequence
CTTATTTCAACTCTCTGACAAATGATTTCACCAAGAGGAAACTGGTTAAC
ACGATAGATCAAGTTACAACATCTGATTTTCAGGGCACTGTTATGCCTTC
CAAAAAAACAATTCAATGAAACATTGTGGCATAATTATGAGAATCTCCTA
GTGATTTTCTTTTGATAACCAGAAACCTTCAAGGTCAATGGCACACAGCT
TGGAACTCAGCGGATAAGGGACCCATCCATGCAACCCTCTCCATTTATAT
ACTAAGAGAATCTCCTAATGAATTGAAGATGACGAATAAGTAATCACCTG
GTTTGAGTGGAGATCAAATATCCCCAACCTATTAAGAGTGCCTATCTCCA
CAGGTAATGAAGTAAGTGCATTATTCCTGTCAAAGTGGATAAAGAAAAGA
ATGGGGCCGCGGTGGAGAGGGAAAATGTGAATGTAACGAA
Genomic location of TG122  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D366 marker 366
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)