Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker TG123

SGN-M367

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2100
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
TG123 image not available
Forward sequence
TAACTGATTGGCTAGATGGATATCCTGCTCCAGGTACATGCTTCTGCTGTTCATAGAATCATTTTTTCTCGAATTATAATTTCTTATATT
TCAACTTTCAAAATTGGCTGGTTTGACACGTCCAGATGAATTTAGGAACTGCCTTTGGTGCATTTTTAGATCCAGTGGCTGATAAGGTAT
TTTCTCTTTATTCTTCAATTCACATGGTATTACCTGGAAGTTTGGCCAGTTTGCTAGTGTTGCTACCATTATCCATAATGTTTGAGACTC
TTCAGCATAATTGCTTGTAATGAAAGAGCAGACATTTTTTGATACAACTCTTCTTGACTTCAACAGCTAATGGTTGCTGCCACATTGATC
TTATTGTGCACCAAACCTTTGGAGGCTAGTTTGTTTGGACAATTTCCATGGCTACTAACTGTACCTTCTATTGCTATAATTGGCAGGGA
Reverse sequence
ATTTGCAAAATGAATCAAAAAACAGTGTTCATCACTCATCCACAATGAAAATAACTAATGATGCAGGGAAAAGATTTTCGAGGAACATGG
AAGAGCATCATATGATGTATATTTGAAAAAGGTACCAAAGAGTGTCATATCATAAATATCATATTGGAAAAAAAGATATCGCACCTTGAG
CAAAAGCGACTACCAGGCTAAATATGGACACTATGATCTCACAGACTATCAGAAAGACTACATACTATGCAAAACTTAATAATCGAAAAA
AATCAAGTGAACAATAAGGTTCATCAAGAGTACCCACAGTTCCAATCCATGTTCTCAAGAGCTCTCGAATTCCTCTTTCTTTTCAATCTA
AGCTGATCACTGCTTGCATGTTTCAGAGAAGTTTATCCTCGCAGCATTACTTAAAATATTCATACTTACTTGACACAAATGAAGAGGAAT
AGTTTTAACTAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1500622e-0630 (6.7% of RFLP seq)+
SGN-U1591885.1e-0735 (7.8% of RFLP seq)+
SGN-U1500621.6e-2253 (11.8% of RFLP seq)+
SGN-U1500621.6e-59115 (25.6% of RFLP seq)+
SGN-U1626322e-179362 (78.2% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53867)
Chromosome
4
Position
27.10 cM
Confidence
uncalculated
Protocol
RFLP

2_Isobutylthiazole_content_ibt4_1 2_Methylthio_ethanol_content_meo4_1 Dry_matter_weight_dmw4_1 6_Methylhept_5_en_2_one_content_mhn4_1 Lycopene_content_lyc4_1 2_Methylbut_2_enal_content_bea4_1Color_L_L4_1 Color_a_a4_1Hexanal_content_hxa4_1 3_Methylpentan_1_ol_content_mno4_1 Elasticity_ela4_1 Color_b_b4_1Firmness_fir4_1
Tomato QTL map

Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53510)
Chromosome
4
Position
30.24 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53166)
Chromosome
4
Position
23.50 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8984)
Chromosome
4
Position
22.10 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8985)
Chromosome
4
Position
21.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8986)
Chromosome
4
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG123 was used as an overgo probe on plate 9 [well E12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTGATTGGCTAGATGGATATCCTG
B sequence
AAGCATGTACCTGGAGCAGGATAT
AB sequence
CTGATTGGCTAGATGGATATCCTGCTCCAG
Marker sequence
TAACTGATTGGCTAGATGGATATCCTGCTCCAGGTACATGCTTCTGCTGT
TCATAGAATCATTTTTTCTCGAATTATAATTTCTTATATTTCAACTTTCA
AAATTGGCTGGTTTGACACGTCCAGATGAATTTAGGAACTGCCTTTGGTG
CATTTTTAGATCCAGTGGCTGATAAGGTATTTTCTCTTTATTCTTCAATT
CACATGGTATTACCTGGAAGTTTGGCCAGTTTGCTAGTGTTGCTACCATT
ATCCATAATGTTTGAGACTCTTCAGCATAATTGCTTGTAATGAAAGAGCA
GACATTTTTTGATACAACTCTTCTTGACTTCAACAGCTAATGGTTGCTGC
CACATTGATCTTATTGTGCACCAAACCTTTGGAGGCTAGTTTGTTTGGAC
AATTTCCATGGCTACTAACTGTACCTTCTATTGCTATAATTGGCAGGGA
Genomic location of TG123  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D367 marker 367
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)