SGN Marker TG233

SGN-M37

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1370
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
ATAGCTGTTAATTCTCCTTCCACGTCACCCTCGTGTCTGCGGCGATTGCTTACATTTACTTCTCCACTGTATTTGTATTCATTGATCAGT
GGTTGGGACTTTGGTCATCTCCCGGTATACTTAACGCCATCCTGTTATCCGTCGTTGCTCTATTCTGCATTTTGAGTTACCCACTTGCAA
TATACACTGATCCGGGTCGGGTTCCTAGCTCATTCATACCCGATGTCGAAAACCCGGAGAATACGGTTCAAGAGATCAAGCGAAAGGTTT
TGTTCGTTTCTTACCTTAACAATTTACTTTAATGTCGTATATTCTACTTGTATTATGCTGCTTAGTGCACAGAGCTGCTTTTTTTTTTTT
TAAGGAGGTAAAGGCTAAAGTGTGTAAACTATTTAATAACACATTGAACTAAAT
Reverse sequence
GTCGTTTTACCAGTTAGAAATTGAGCTGAATGGACCATGCCTTTTTCTTGGGATGAAAATTGAGAAGGGAACTCTCTGAACAAGGGCATA
CTTAGGAGTTGACGCCACTATTAAAAGGTTGTGATTTTTGTGGCCAGATTATAGGCTCTATTTACGAGTAGGGAAGAAAAGGGGTTATTT
CTCTGCTAACCCTCTCTACTCATTATAGTCGCGACAACTAATTTTTTAAAGCACCTCACTATTACATTGTACTTCCATTGGCAGTGCATG
CCACATTAGAGTACCTATTCAAAACAATCTCCATACAAGGGCAGGGGGACAGTGTTGGGTAATAGGTGACTTCTGCATGAAACTAAAAAC
ATCTTCTTCTTTTTGCAGCATCAAGTAACAAAGGAGGTTTAGAACAGTTTGTTTCTTTTGCAATGGATTGGATTTTCTCGATATTGACAA
TGAAATGCTTATCTAAAGAGGCAAAGACTTTAAAAGAAGAAAGTTTTGGGATAGAGCACAGTTAAAGGGGTTCCAACCTCGAATTCCATA
AGTACAAAAGAATAATCCTCCGTGTTTTCATTCAGCTCACAGAGGGACGAAATCACTGTATACAGTTAACAGATATTGAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1634682.1e-15249 (60.1% of RFLP seq)+
SGN-U1634691e-127257 (62.1% of RFLP seq)+
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50356)
Chromosome
10
Position
64.68 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48290)
Chromosome
10
Position
86.07 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43848)
Chromosome
10
Position
93.10 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43308)
Chromosome
10
Position
81.80 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42422)
Chromosome
10
Position
88.10 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39952)
Chromosome
10
Position
86.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 7823)
Chromosome
10
Position
101.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 7825)
Chromosome
10
Position
69.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7824)
Chromosome
10
Position
90.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Other PCR data 
PCR data   Exp. ID 14001
Forward primer (5'-3')
CATGCCTTTTTCTTGGGATG
Digested band sizes (using AluI)
Solanum pennellii LA716: 430
Solanum lycopersicum LA925: 500
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGGAACCCCTTTAACTGTGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 500
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 14001
Forward primer (5'-3')
CATGCCTTTTTCTTGGGATG
Digested band sizes (using AluI)
Solanum lycopersicum LA925: 500
Solanum pennellii LA716: 430
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGGAACCCCTTTAACTGTGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 500
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 14147
Forward primer (5'-3')
Unknown
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Approximate temperature
55°C
  
PCR data   Exp. ID 134
Forward primer (5'-3')
Unknown
Digested band sizes (using AluI)
Solanum lycopersicum LA925: 500
Solanum pennellii LA716: 430
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 500
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG233 was used as an overgo probe on plate 3 [well H12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGTGGTTGGGACTTTGGTCATCTC
B sequence
GCGTTAAGTATACCGGGAGATGAC
AB sequence
AGTGGTTGGGACTTTGGTCATCTCCCGGTA
Marker sequence
ATAGCTGTTAATTCTCCTTCCACGTCACCCTCGTGTCTGCGGCGATTGCT
TACATTTACTTCTCCACTGTATTTGTATTCATTGATCAGTGGTTGGGACT
TTGGTCATCTCCCGGTATACTTAACGCCATCCTGTTATCCGTCGTTGCTC
TATTCTGCATTTTGAGTTACCCACTTGCAATATACACTGATCCGGGTCGG
GTTCCTAGCTCATTCATACCCGATGTCGAAAACCCGGAGAATACGGTTCA
AGAGATCAAGCGAAAGGTTTTGTTCGTTTCTTACCTTAACAATTTACTTT
AATGTCGTATATTCTACTTGTATTATGCTGCTTAGTGCACAGAGCTGCTT
TTTTTTTTTTTAAGGAGGTAAAGGCTAAAGTGTGTAAACTATTTAATAAC
ACATTGAACTAAAT
Genomic location of TG233  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D37 marker 37
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)