SGN Marker CD55

SGN-M370

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
500
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CATCCTCACTATATCGGTAGAGATCCAAAGTCGTGACACCTAAATATTCGATACCAATAGATCTGTTCTTATAACCTATCTAATCAATGT
TTCCCCACAGATGTTCAGTGTGTGTCGAATCCTCTTTTTGAAGAGTCCGAGCACATAGTACACCCTAAGGTAAGAACAACAGAGCAGGAC
CACAACCACTGATTTGTGGGATCATTCACTAAAATTTGGGTAAGGACGAAAAGTAAAAGTTGTATCTTGCAATGGAGCAGCTTACTCCTG
ACATGGATCATGGAATTGAATTTATACAAAAAAATGATTTTTCAAGTTTCTTAATCGAAATAAACTATCACTAACTATTTATCGAAACAC
AACTCATCTATTAATTGTTCACAAACTCTTTTTAGATTTTGCCCTAATGTTTGATTAATTTTTACGAATTAGGGCGATATCGCACACCAA
TCTCTCTATATATACTTTTATATTTCTCGGCATTGATATAAAAATATAATTGTACTTATAATAATTTTAACGAGATATCTGGACCATTAA
GAATAAAATGTTGTTAATGATATCAATTAATA
Reverse sequence
not available
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51727)
Chromosome
4
Position
46.91 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42282)
Chromosome
4
Position
65.90 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38940)
Chromosome
4
Position
72.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8992)
Chromosome
4
Position
45.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8991)
Chromosome
4
Position
52.40 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8996)
Chromosome
4
Position
25.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
CD55 was used as an overgo probe on plate 7 [well C6]

Plausible BAC Matches:   P112B07,   P242B02,   P069A04,   P273F16,   P271P14

 Overgo Sequences

A sequence
TCCGAGCACATAGTACACCCTAAG
B sequence
GCTCTGTTGTTCTTACCTTAGGGT
AB sequence
TCCGAGCACATAGTACACCCTAAGGTAAGA
Marker sequence
CATCCTCACTATATCGGTAGAGATCCAAAGTCGTGACACCTAAATATTCG
ATACCAATAGATCTGTTCTTATAACCTATCTAATCAATGTTTCCCCACAG
ATGTTCAGTGTGTGTCGAATCCTCTTTTTGAAGAGTCCGAGCACATAGTA
CACCCTAAGGTAAGAACAACAGAGCAGGACCACAACCACTGATTTGTGGG
ATCATTCACTAAAATTTGGGTAAGGACGAAAAGTAAAAGTTGTATCTTGC
AATGGAGCAGCTTACTCCTGACATGGATCATGGAATTGAATTTATACAAA
AAAATGATTTTTCAAGTTTCTTAATCGAAATAAACTATCACTAACTATTT
ATCGAAACACAACTCATCTATTAATTGTTCACAAACTCTTTTTAGATTTT
GCCCTAATGTTTGATTAATTTTTACGAATTAGGGCGATATCGCACACCAA
TCTCTCTATATATACTTTTATATTTCTCGGCATTGATATAAAAATATAAT
TGTACTTATAATAATTTTAACGAGATATCTGGACCATTAAGAATAAAATG
TTGTTAATGATATCAATTAATA
Genomic location of CD55  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D370 marker 370
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)