SGN Marker TG40

SGN-M371

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1700
Vector
pUC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
CGGGCGAGCTCGAATTCAATTCCAACATAATTGTTTTCATTGTAGCAACAAAAATCTTTAACTTTTCATAAGATAAAACGTTATTCAAAC
TTTTCCCAAAAATCCACATTAAGATAAATCCTAATAAACCCCAATTAAACCAAACTTCCTAAGAACAATTAATGACCGACCAAAAAAATG
AATTGAAGTCTAAAGTCAGTCAACAACAACAACAACTGCACCTCAGTCCCAAACACAAATTCTGGAGCAGAAAACATATCAATTAGTTAT
CAAAAATCCAGTTCAGAATTAAACCCAATTTAAGAAAAAAAAGTCTATCAACAATAAAAATAATATAAAACATTTCAACTAGTTACCAAA
AAAGCTCAGTTCACAATTAAACCCAATTGGATAAGATCCACAAGCAAACTGCCAAAAACTTCCGATAAGGATCGGAAAAACTAAAATCCC
GAAATACCCCAAACCCTAAAGCTATCAAAGTAAAAAACAAGCAAAAAAACTAAAAAAAATGGAAATCAAAACAATTAATAGTGGAAA
Reverse sequence
ATTCCAACATAGTTGTTTTCATTGTAGCAACAAAAATCTTTAACTTTTCATAAGATAAAACGTTATTCAAACTTTTCCCAAAAATCCACA
TTAAGATAAATCCNNATAAACCCCAATTAAACCAAACTTCCTAAAAACAATTAATGGACGACCAAAAAAATGAATTGAAGATCTAAAGTC
AATCACAACAACAACAACTGCACCTCAGTCCCAAACACAAATTCTGGAGCAGAAAACATTTCAATTAGTTATCAAAAATCCAGTTCGAAA
TTAAACCCAATTTAAAAAAAAAAAGTCTATCAACAATAAAAATAATATTAAACATTTTCAACTAGTTACCAAAAAAGCTCAGTTCACAAT
TAAACCCAATTGGATAAGATCCACAGCAAACTGCCAAAAACTTCGATAAGGATCGGAAAAACTAAAATCCCGAAATACCCCAAACCCTAA
AGCATCAAAGNTAAAAACAAGCAAAAAACTGAAAAAAATGGGAAATCAAACAATT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53857)
Chromosome
3
Position
0.00 cM
Confidence
uncalculated
Protocol
RFLP

Titratable_acidity_ta3_1 Fruit_diameter_fd3_1 Elasticity_ela3_1 Fruit_weight_fw3_1 2_Phenylethanal_content_pea3_1 Carotene_content_car3_1 Sugar_content_suc3_1
Tomato QTL map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53296)
Chromosome
3
Position
31.88 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_3 MQTL_2_Late_blight_3 MQTL_3_Late_blight_3
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40028)
Chromosome
4
Position
126.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8997)
Chromosome
3
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8998)
Chromosome
3
Position
3.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9001)
Chromosome
3
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG40 was used as an overgo probe on plate 2 [well D7]

Plausible BAC Matches:   P226H09,   P073G06,   P122I16,   P029G15,   P207M03,   P212G06,   P158P14,   P080C09,   P147J11,   P040F02,   P141A13,   P209F13,   P051L15,   P151L01,   P001L04

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
AACAACTGCACCTCAGTCCCAAAC
B sequence
CTGCTCCAGAATTTGTGTTTGGGA
AB sequence
AACAACTGCACCTCAGTCCCAAACACAAAT
Marker sequence
CGGGCGAGCTCGAATTCAATTCCAACATAATTGTTTTCATTGTAGCAACA
AAAATCTTTAACTTTTCATAAGATAAAACGTTATTCAAACTTTTCCCAAA
AATCCACATTAAGATAAATCCTAATAAACCCCAATTAAACCAAACTTCCT
AAGAACAATTAATGACCGACCAAAAAAATGAATTGAAGTCTAAAGTCAGT
CAACAACAACAACAACTGCACCTCAGTCCCAAACACAAATTCTGGAGCAG
AAAACATATCAATTAGTTATCAAAAATCCAGTTCAGAATTAAACCCAATT
TAAGAAAAAAAAGTCTATCAACAATAAAAATAATATAAAACATTTCAACT
AGTTACCAAAAAAGCTCAGTTCACAATTAAACCCAATTGGATAAGATCCA
CAAGCAAACTGCCAAAAACTTCCGATAAGGATCGGAAAAACTAAAATCCC
GAAATACCCCAAACCCTAAAGCTATCAAAGTAAAAAACAAGCAAAAAAAC
TAAAAAAAATGGAAATCAAAACAATTAATAGTGGAAA
Genomic location of TG40  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D371 marker 371
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)