SGN Marker TG41

SGN-M374

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1700
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CTGGGCTGAGCTTTGCTCTAGCTGATGAGGGTGTCGAAGGTAACAAAGAAGCAACTGTTACAGCAGCTCTTAGTTTTGTTGCCAAAGGGG
GAGAACTGCTCAAACGTACAAGAAAAGGTAAAATAAATCGAGGAACTACACTTATCTTTCTGGAGATATTGCAGCTGTTTTTTCAACAAT
ATTTCTGTTCATGCAGGAGATCTACACTGGAAACAAGTCTCTTTCACCATAAACTCAGATTGGCAGGTAATATGCAGAGTATACTATTTA
AATGGATAGACTGTCTATTAGAAACGTGAACATCTTTTAAGCAGTTAGATTAAAAGCAACAAACTTTACATGTGCACCCCTACATGGTTG
TTATTTCATGTTTTGCCTATATTATCATAACAGAAGTGCAAATATGAATCTTGCTAGCAGGTGATAGCTAAAATGAAAAGCAAGCATATG
GGAGGAACATTCACAAAGAAAAAGGAATGTAAGCACAAACCAATACTCACTCTAGTATCAAATTGTGTATGTGATCCATTACACTTTCAT
CTAAATTGGTGCTTGATGAGGGCCCAGGTGTGGT
Reverse sequence
CTGATGAGGGTGTCGAAGGTAACAAAGAAGCAACTGTTACAGCAGCTCTTAGTTTTGTTGCCAAAGGGGGAGAACTGCTCAAACGTACAA
GAAAAGGTAAAATAAATCGAGGAACTACACTTATCTTTCTGGAGATATTGCAGCTGTTTTTTCAACAATATTTCTGTTCATGCAGGAGAT
CTACACTGGAAACAAGTCTCTTTCACCATAAACTCAGATTGGCAGGTAATATGCAGAGTATACTATTTAAATGGATAGACTGTCTATTAG
AAACGTGAACATCTTTTAAGCAGTTAGATTAAAAGCAACAAACTTTACATGTGCACCCCTACATGGTTGTTATTTCATGTTTTGCCTATA
TTATCATAACAGAAGTGCAAATATGAATCTTGCTAGCAGGTGATAGCTAAAATGAAAAGCAAGCATATGGGAGGAACATTCACAAAGAAA
AAGGAATGTAAGCACAAACCAATACTCACTCTAGTATCAAATTGTGTATGTGATCCATTACACTTTCATCTAAATTGGTGCTTGATGAGG
GCCCAGGT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53302)
Chromosome
8
Position
81.78 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_8 MQTL_1_Maturity_8 MQTL_2_Late_blight_8
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42457)
Chromosome
8
Position
43.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-COSII

Map: Eggplant-LXM 2002   
Map version
29 (location: 9005)
Chromosome
8
Position
27.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9004)
Chromosome
8
Position
23.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9006)
Chromosome
8
Position
11.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG41 was used as an overgo probe on plate 13 [well C7]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P134L20,   P186H10,   P168O13

 Overgo Sequences

A sequence
CTGAGCTTTGCTCTAGCTGATGAG
B sequence
TGTTACCTTCGACACCCTCATCAG
AB sequence
CTGAGCTTTGCTCTAGCTGATGAGGGTGTC
Marker sequence
CTGGGCTGAGCTTTGCTCTAGCTGATGAGGGTGTCGAAGGTAACAAAGAA
GCAACTGTTACAGCAGCTCTTAGTTTTGTTGCCAAAGGGGGAGAACTGCT
CAAACGTACAAGAAAAGGTAAAATAAATCGAGGAACTACACTTATCTTTC
TGGAGATATTGCAGCTGTTTTTTCAACAATATTTCTGTTCATGCAGGAGA
TCTACACTGGAAACAAGTCTCTTTCACCATAAACTCAGATTGGCAGGTAA
TATGCAGAGTATACTATTTAAATGGATAGACTGTCTATTAGAAACGTGAA
CATCTTTTAAGCAGTTAGATTAAAAGCAACAAACTTTACATGTGCACCCC
TACATGGTTGTTATTTCATGTTTTGCCTATATTATCATAACAGAAGTGCA
AATATGAATCTTGCTAGCAGGTGATAGCTAAAATGAAAAGCAAGCATATG
GGAGGAACATTCACAAAGAAAAAGGAATGTAAGCACAAACCAATACTCAC
TCTAGTATCAAATTGTGTATGTGATCCATTACACTTTCATCTAAATTGGT
GCTTGATGAGGGCCCAGGTGTGGT
Genomic location of TG41  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D374 marker 374
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)