SGN Marker TG42

SGN-M375

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
3300
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TTTTAGAACTTGGCATCCCTTGAAGATACTTAATATTAAAGATGGTTCACGAGATCAAAGTCATGCTAATTCCAATTTAGCGGCACTACG
ACATTATTATGCCTGTTTTGTAATTTGTATCTATATTTTTCCTCTTTTTCTTGCGTTGCTGGAGAACGTTGGTTTGCTAGAACCCTACAT
CACCACTGTCACACTAATTCTGTTGGCGTTGCCCTTATTTAGGCTCTGCTGCTGATTTTCTATATTATAAAACCTTTATGCAAGTCCGTG
GTCTCCCTTGTGCTCACAACTTTCATGTTGCGTGCATTGATGAATGGCTTCCCCTATAGCGAAAAATGCCCTAGATGCCGTTGCTCTGGT
TTTCCAAATCTAGATCTCAGTGCTTTGTCAAATATCCGTGCTGATCTATAAAGATCATCAACCAACATTGTGACGACACCCCGGTATGTG
AGTATCCCAACCTTCTAGCCAAAGCTATCTGCTGATGTTGCAAGGATTTCTCCGTCCTGTGCGCACATAGAATGCT
Reverse sequence
AGGATATTTTAGAACTTGGCATCCCTTGAAGATACTTAATATTAAAGATGGTTCAGGAGATCAAAGTCATGCTAATTCCAATTTAGCGGC
ACTACGACATTATTATGCCTGTTTTGTAATTTGTATCTATATTTTTCCTCTTTTTCTTGTGTTGTTGGAGAAGGTTGGTTTGCTAGAAGC
CAACATCACGACTGTCGCACTAGTTCTGTTGGTGTTGCCCTTATTTAGGCTCTGCTGCTGTTTTTCTTATTAGAAAACCTTTATGCAGGT
CCGTGGTCTCCCTTGTGCTCACAACTTTCATGTTGCGTGCATTGATGAATGGCTTCGCCTAAACGTAAAATGCCCTAGATGCCGTTGTTC
TGTTTTTCCAAATCTTGATCTCAGTGCTTTGTCAAATATCCGTGCTGATCTAGAAAGATCATCAACCAACATTGTGACAGCAGCCCGGTA
TGTGAGATCCCAACCTTCTAGCCAGAGCTATCTGCTGAGGTTGCAAGGTTTTCTCCGTCCTGTGCGCACAGAGAATGCTGGTCCAAGCAG
TGAGGAAAATGCAGCTG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1636033e-24132 (25.1% of RFLP seq)+
SGN-U1636028e-105263 (50.0% of RFLP seq)+
SGN-U1636033.2e-61254 (45.6% of RFLP seq)-
SGN-U1636022e-164291 (52.2% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53307)
Chromosome
3
Position
66.32 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_3 MQTL_2_Late_blight_3 MQTL_3_Late_blight_3
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9007)
Chromosome
3
Position
77.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9008)
Chromosome
3
Position
26.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG42 was used as an overgo probe on plate 2 [well G11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGAGAACGTTGGTTTGCTAGAACC
B sequence
GACAGTGGTGATGTAGGGTTCTAG
AB sequence
GGAGAACGTTGGTTTGCTAGAACCCTACAT
Marker sequence
TTTTAGAACTTGGCATCCCTTGAAGATACTTAATATTAAAGATGGTTCAC
GAGATCAAAGTCATGCTAATTCCAATTTAGCGGCACTACGACATTATTAT
GCCTGTTTTGTAATTTGTATCTATATTTTTCCTCTTTTTCTTGCGTTGCT
GGAGAACGTTGGTTTGCTAGAACCCTACATCACCACTGTCACACTAATTC
TGTTGGCGTTGCCCTTATTTAGGCTCTGCTGCTGATTTTCTATATTATAA
AACCTTTATGCAAGTCCGTGGTCTCCCTTGTGCTCACAACTTTCATGTTG
CGTGCATTGATGAATGGCTTCCCCTATAGCGAAAAATGCCCTAGATGCCG
TTGCTCTGGTTTTCCAAATCTAGATCTCAGTGCTTTGTCAAATATCCGTG
CTGATCTATAAAGATCATCAACCAACATTGTGACGACACCCCGGTATGTG
AGTATCCCAACCTTCTAGCCAAAGCTATCTGCTGATGTTGCAAGGATTTC
TCCGTCCTGTGCGCACATAGAATGCT
Genomic location of TG42  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D375 marker 375
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)