SGN Marker TG44

SGN-M377

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1300
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
GCTGCAGTCGTATTTCGGTGCCAACGTCTTAATACTCGAACAATTGTTCCAGTGATGCAATATGACATTCCAATAGTTATAAAAAATATT
TTCAACCTTTCTGCACCTGGAACAATGATCTGCCGATCTTCTGGAAATGAATACGAAGATGGACAAAAATTGGAATCCCTTGTCAAAGGA
TTTGCAACAATTGACAATGTAGCCCTTGTGAATGTTGAGGGGTAAGGCTGCGCTTGTTTCAGGAGTAGTCAATGTACGATTTCCTTATTT
TACATGATGCTTATTACCCTTTTTCAGAACCGGAATGGCTGGTGTTCCTGGTACTGCTAGCGCCATTTTTAGTGCAGTAAAAGACGTTGG
TGCTAATGTAATCATGATATCCCAGGTACATTAATCCACTGATTCCTGTTTTAGTTATTACTATTATGATTACAAGTACTTTAATTGGCA
GCTATATTGCAGGCTAGCAGTGAGCATTCAGTGTGCTTTGCTGTGCCTGAGAAAGAGGTGAAAGCCGTTGCGGAT
Reverse sequence
TTCGGTGCCAATCTCTTACATCCTCGACAATTGTTCCAGTGATGCAATATGACATTCCAATAGTTATAAAAAATATTTTCAACCTTTCTG
CACCTGGAACAATGATCTGCCGATCTTCTGGAAATGAATACGAAGATGGACAAAAATTGGAATCCCTTGTCAAAGGATTTGCAACAATTG
ACAATGTAGCCCTTGTGAATGTTGAGGGGTAAGGCTGCGCTTGTTTCAGGAGTAGTCAATGTACGATTTCCTTATTTTACATGATGCTTA
TTACCCTTTTTCAGAACCGGAATGGCTGGTGTTCCTGGTACTGCTAGCGCCATTTTTAGTGCAGTAAAAGACGTTGGTGCTAATGTAATC
ATGATATCCCAGGTACATTAATCCACTGATTCCTGTTTTAGTTATTACTATTATGATTACAAGTACTTTAATTGGCAGCTATATTGCAGG
CTAGCAGTGAGCATTCAGTGTGCTTTGCTGTGCCTGAGAAAGAGGTGAAAGCCGTTGCGGATGTTTTGGA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1703242.6e-1268 (13.0% of RFLP seq)+
SGN-U1703242.8e-1890 (17.1% of RFLP seq)+
SGN-U1563343.2e-3066 (12.6% of RFLP seq)+
SGN-U1703249.1e-40182 (34.7% of RFLP seq)+
SGN-U1563341.5e-4490 (17.1% of RFLP seq)+
SGN-U1563343e-110216 (41.1% of RFLP seq)+
SGN-U1703246.4e-1373 (14.0% of RFLP seq)-
SGN-U1703242.7e-1890 (17.3% of RFLP seq)-
SGN-U1563345.3e-3574 (14.2% of RFLP seq)-
SGN-U1703243.7e-42206 (39.6% of RFLP seq)-
SGN-U1563341.5e-4490 (17.3% of RFLP seq)-
SGN-U1563342e-108209 (40.2% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53323)
Chromosome
11
Position
35.52 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_11 MQTL_1_Maturity_11 MQTL_2_Late_blight_11 MQTL_2_Maturity_11
Potato meta-QTL consensus map

Map: Pepper-AC99   
Map version
34 (location: 9012)
Chromosome
8
Position
25.04 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9011)
Chromosome
11
Position
47.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9010)
Chromosome
11
Position
23.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG44 was used as an overgo probe on plate 10 [well H3]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P168I01,   P032B16,   P017D04,   P167I14,   P026D21

 Overgo Sequences

A sequence
ATTGCAGGCTAGCAGTGAGCATTC
B sequence
CACAGCAAAGCACACTGAATGCTC
AB sequence
ATTGCAGGCTAGCAGTGAGCATTCAGTGTG
Marker sequence
GCTGCAGTCGTATTTCGGTGCCAACGTCTTAATACTCGAACAATTGTTCC
AGTGATGCAATATGACATTCCAATAGTTATAAAAAATATTTTCAACCTTT
CTGCACCTGGAACAATGATCTGCCGATCTTCTGGAAATGAATACGAAGAT
GGACAAAAATTGGAATCCCTTGTCAAAGGATTTGCAACAATTGACAATGT
AGCCCTTGTGAATGTTGAGGGGTAAGGCTGCGCTTGTTTCAGGAGTAGTC
AATGTACGATTTCCTTATTTTACATGATGCTTATTACCCTTTTTCAGAAC
CGGAATGGCTGGTGTTCCTGGTACTGCTAGCGCCATTTTTAGTGCAGTAA
AAGACGTTGGTGCTAATGTAATCATGATATCCCAGGTACATTAATCCACT
GATTCCTGTTTTAGTTATTACTATTATGATTACAAGTACTTTAATTGGCA
GCTATATTGCAGGCTAGCAGTGAGCATTCAGTGTGCTTTGCTGTGCCTGA
GAAAGAGGTGAAAGCCGTTGCGGAT
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG44  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D377 marker 377
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)