SGN Marker U237757

SGN-M3795

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U237757
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40245)
Chromosome
1
Position
102.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14060
Forward primer (5'-3')
ATCGGCTGCTGATGTTTATGATCG
Digested band sizes (using DraI)
Solanum pennellii LA716: 1650
Solanum lycopersicum LA925: 1700
Mg+2 concentration
Unknown
Reverse primer (5'-3')
ACAACATCCCTCCATAGAGTTTCAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 2000
Solanum lycopersicum LA925: 2000
Approximate temperature
50°C
  
PCR data   Exp. ID 14060
Forward primer (5'-3')
ATCGGCTGCTGATGTTTATGATCG
Digested band sizes (using DraI)
Solanum pennellii LA716: 1650
Solanum lycopersicum LA925: 1700
Mg+2 concentration
Unknown
Reverse primer (5'-3')
ACAACATCCCTCCATAGAGTTTCAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 2000
Solanum lycopersicum LA925: 2000
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
U237757 was used as an overgo probe on plate 12 [well G8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ACTCGGGAGAAATTCGGGAGATTC
B sequence
CCGGAAACCGATAGAAGAATCTCC
AB sequence
ACTCGGGAGAAATTCGGGAGATTCTTCTAT
Marker sequence
ATGATAAACAGCACAACTGAAAGCACAGACGTTCCAACACAAAAGTACCA
CCTACCAAAGCGTATAATCTTGGTCCGTCACGGCGAGAGCCAAGGGAACA
AGGACGATGCAGCATACGGCGTAACCCCAGATTACAAAATCCCTTTGACG
GCTCAAGGGATTGAACAAGCAAAACAAGCTGGCTCCCGGATTCTTGATGT
TGTTTCCGGCCATGGGTCGTCGGACAACTGGAAGGTTTACTTCTATGTCT
CTCCTTACGTGCGCACGCGCTCCACGCTCCGGGAGATTGGCCGGGCATTC
CCGAAGAATAGGATGCTTGGGGTTAGAGAAGAGTGCAGAGTTAGAGAACA
AGATTTTGGGAATTTTCAAGTCGCTGAGCGTATGAAAGTGATTAAGGAAA
CTCGGGAGAAATTCGGGAGATTCTTCTATCGGTTTCCGGAAGGCGAATCG
GCTGCTGATGTTTATGATCGAGTTTCNNNNN
Genomic location of U237757  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3795 marker 3795
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)