SGN Marker TG23

SGN-M38

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2500
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CTAAAAGTTAAAAGGGTTAGCTAAATTTGGTGGTTCAAATCCTTATTGGATAATGAATCAGTCCAACTTGACAACAACTATTAAATTGTA
TAGTTGTAAACTGTTTAATAGCACTTTTTTTTCCGAGCGAAGAGTCTAGAGTCTATCGGAAACTACCTCTCTACCCCGCTCGTAGAATTA
GAATGAGTATGTTGTTGTTGTTTATCGTTTGATTGAACCGTTGCTACTTTTGTGGAAAGTATTTGTGTTGAAGCTCTTAGTAGATAATCA
TATAAAAAATTATACTTTTGAAGTTGAAAATTGAAATAACTTAAATAAGCTTATGCAGTTCTTGTGTAATTTCAGATCAAGAGGGAGATT
GGAACTTTAAAACTCCTCAAACATCCTAACGTTGTCCGATTATACGAGGTATATACCATCCTTCTCCTTTTCCTTTTGCCTTCTTTCAAT
AAACTCGGAATATTATCACTTTAATAATATTATTATCTTTTGAACATAAAAAACTCCTAATATACACAAGTTGAGGTATTGAAATGTTTT
CCGGATACAAGTTGTGTTTGTAGTGGTGATAAAGTATTTCCACCTAAAGATTCAGTATATAAAGTGGATTATATTATATAATTCGTATTA
TTCTTCGAAAACAATGAGTAAA
Reverse sequence
GTATATGAACTTCCCCCTTAAGTATCTGATTTATATTCATCAAAAATAATATTAAATGTATTAGCTTTACCAAATGTCATATAAAATGAG
CACGCACGCATAAAACAGAAGAAGAAATTGTCTTACCTTTTGATAAAGTACGGCAAGATTTCTATCATCAAAGGGTAAATAACCAGTGAG
AATAACATATAAGATAACACCACATGACCAGGTATCAGATGCCGCGCCATCATATCCTCTGTTAGAAAGAATTTCTGGAGCGACATAGTT
TGGACTACCGCAAGTGGTGTGCAACAATCCGTCATCCTATAGTTAAGACAGAAAAGCTCAATAAGATTTAGGAAACTAATTCACATATGC
AACAAAGAGAAGCTGGTATATTCCGTACCCTAAAGTGTTGGGGTAACGCACTGAGCCCAAAGTCCGTTATTTTTATGTTTCCCCTCAAAT
CAATGAGGACGTTTTCTAGCTGCATTTTCAACACCACACATGTTACATGACTGAATAACAGCTTATAATATTTATGCTACACACTATATA
ATTAGTTACCTTGAGATCTCTGTGGAAGACACCTTTGTCGTGACAGT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1450506.5e-3269 (10.6% of RFLP seq)+
SGN-U1450506.7e-0727 (4.6% of RFLP seq)-
SGN-U1450501.8e-1338 (6.5% of RFLP seq)-
SGN-U1450506.5e-4184 (14.3% of RFLP seq)-
SGN-U1613562.1e-96181 (30.8% of RFLP seq)-
SGN-U1450502.1e-96181 (30.8% of RFLP seq)-
SGN-U1613564e-110200 (34.1% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53225)
Chromosome
5
Position
44.04 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_5 MQTL_1_Maturity_5 MQTL_2_Late_blight_5
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39950)
Chromosome
5
Position
99.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Pepper-AC99   
Map version
34 (location: 7832)
Chromosome
5
Position
34.76 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7829)
Chromosome
5
Position
70.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 7835)
Chromosome
5
Position
40.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 7834)
Chromosome
5
Position
90.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPIMP 2001
Other PCR data 
PCR data   Exp. ID 35621
Forward primer (5'-3')
GGTGGTTCAAATCCTTATTGG
Digested band sizes (using HaeIII)
Solanum lycopersicum LA925: 1200
Solanum pennellii LA716: 1600
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAAGTGTTGGGGTAACGCAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1700
Solanum pennellii LA716: 1700
Approximate temperature
55°C
  
PCR data   Exp. ID 74
Forward primer (5'-3')
Unknown
Digested band sizes (using HaeIII)
Solanum lycopersicum LA925: 1200
Solanum pennellii LA716: 1600
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1700
Solanum lycopersicum LA925: 1700
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG23 was used as an overgo probe on plate 5 [well F12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCGAAGAGTCTAGAGTCTATCGGA
B sequence
GGGTAGAGAGGTAGTTTCCGATAG
AB sequence
GCGAAGAGTCTAGAGTCTATCGGAAACTAC
Marker sequence
CTAAAAGTTAAAAGGGTTAGCTAAATTTGGTGGTTCAAATCCTTATTGGA
TAATGAATCAGTCCAACTTGACAACAACTATTAAATTGTATAGTTGTAAA
CTGTTTAATAGCACTTTTTTTTCCGAGCGAAGAGTCTAGAGTCTATCGGA
AACTACCTCTCTACCCCGCTCGTAGAATTAGAATGAGTATGTTGTTGTTG
TTTATCGTTTGATTGAACCGTTGCTACTTTTGTGGAAAGTATTTGTGTTG
AAGCTCTTAGTAGATAATCATATAAAAAATTATACTTTTGAAGTTGAAAA
TTGAAATAACTTAAATAAGCTTATGCAGTTCTTGTGTAATTTCAGATCAA
GAGGGAGATTGGAACTTTAAAACTCCTCAAACATCCTAACGTTGTCCGAT
TATACGAGGTATATACCATCCTTCTCCTTTTCCTTTTGCCTTCTTTCAAT
AAACTCGGAATATTATCACTTTAATAATATTATTATCTTTTGAACATAAA
AAACTCCTAATATACACAAGTTGAGGTATTGAAATGTTTTCCGGATACAA
GTTGTGTTTGTAGTGGTGATAAAGTATTTCCACCTAAAGATTCAGTATAT
AAAGTGGATTATATTATATAATTCGTATTATTCTTCGAAAACAATGAGTA
AA
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG23  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D38 marker 38
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)