SGN Marker TG45

SGN-M380

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2000
Vector
pUC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
ATTTATTGGCTCTCTCTGTTCGGGGTTTCCTGTTCCAATTAGTTTGTGTCAGCATCAGTTGGCCAACTGTCACTTTTGCAATTATGATGT
ATAAAGTGAAAGGGATATGGAACAGATAAGAAAGGTGGTAGTTCTATGAGCGGAACTTGTCATCCATCATTTCTTACCTCATCCAATTCT
CTATTGTGCATTCTCCAGCTTCACTGTCGTCTGGTCCTTTCTGATTTAAGTCATTATGATATTTATGTTGTGATCTCTTTCTGAGGTTTC
ACTGAGCTTAGAACTGCGGTAGCATTTTAGAATCAGAGTGTTTGATAATTTGCAAAATCTTGTTTTTTTCTTGCAGATAACAGATGCATT
TAAAAATGGCCACTCAAACACTGTACTGGAGATCATTGGATTGGGTATGACCCACATAATTGATATTGGCAGGTTTGATGGCGTGGAAGT
TCTATTGAAACATTCACCAGTAGTGAAGTCT
Reverse sequence
AATTTATTGGCTCTCTCTGTTCGGGGTTTCCTGTTCCAATTAGTTTGTGTCAGCATCAGTTGGCCAACTGTCACTTTTGCAATTATGATG
TATAAAGTGAAAGGGATATGGAACAGATAAGAAAGGTGGTAGTTCTATGAGCGGAACTTGTCATCCATCATTTCTTACCTCATCCAATTC
TCTATTGTGCATTCTCCAGCTTCACTGTCGTCTGGTCCTTTCTGATTTAAGTCATTATGATATTTATGTTGTGATCTCTTTCTGAGGTTT
CACTGAGCTTAGAACTGCGGTAGCATTTTAGAATCAGAGTGTTTGATAATTTGCAAAATCTTGTTTTTTTCTTGCAGATAACAGATGCAT
TTAAAAATGGCCACTCAAACACTGTAGTGGAGATCATTGGATTGGGTATGACCCAGATAATTGATATTGGCAGGTTTGATGGCGTGGAAG
TTCTATTGAAACATTCACCAGTAGTGAAGTCTTC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53858)
Chromosome
8
Position
8.10 cM
Confidence
uncalculated
Protocol
RFLP

Carotene_content_car8_12_Methylthio_ethanol_content_meo8_1Hex_3_en_1_ol_content_x3o8_1 2_Phenylethanal_content_pea8_1 3_Methylthio_propanal_content_mta8_1
Tomato QTL map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53328)
Chromosome
8
Position
77.50 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_8 MQTL_1_Maturity_8 MQTL_2_Late_blight_8
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50391)
Chromosome
8
Position
46.48 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48325)
Chromosome
8
Position
26.23 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40047)
Chromosome
8
Position
20.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9017)
Chromosome
8
Position
16.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9020)
Chromosome
8
Position
7.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 9019)
Chromosome
8
Position
28.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG45 was used as an overgo probe on plate 12 [well G3]

Plausible BAC Matches:   P100I03,   P303A23,   P156F17,   P154B16,   P099D01,   P167G24,   P325P21,   P145N21,   P164O01,   P234L06,   P156N08,   P161I14,   P038C11,   P302A24,   P331L21,   P315H01,   P281C05

 Overgo Sequences

A sequence
TGTGCATTCTCCAGCTTCACTGTC
B sequence
TCAGAAAGGACCAGACGACAGTGA
AB sequence
TGTGCATTCTCCAGCTTCACTGTCGTCTGG
Marker sequence
ATTTATTGGCTCTCTCTGTTCGGGGTTTCCTGTTCCAATTAGTTTGTGTC
AGCATCAGTTGGCCAACTGTCACTTTTGCAATTATGATGTATAAAGTGAA
AGGGATATGGAACAGATAAGAAAGGTGGTAGTTCTATGAGCGGAACTTGT
CATCCATCATTTCTTACCTCATCCAATTCTCTATTGTGCATTCTCCAGCT
TCACTGTCGTCTGGTCCTTTCTGATTTAAGTCATTATGATATTTATGTTG
TGATCTCTTTCTGAGGTTTCACTGAGCTTAGAACTGCGGTAGCATTTTAG
AATCAGAGTGTTTGATAATTTGCAAAATCTTGTTTTTTTCTTGCAGATAA
CAGATGCATTTAAAAATGGCCACTCAAACACTGTACTGGAGATCATTGGA
TTGGGTATGACCCACATAATTGATATTGGCAGGTTTGATGGCGTGGAAGT
TCTATTGAAACATTCACCAGTAGTGAAGTCT
Genomic location of TG45  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D380 marker 380
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)