SGN Marker C2_At1g30580

SGN-M3811
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle312242 (SGN)
126015 (CGN)
---
Capsicum annuumSingleSGN-U196800---
Lycopersicon CombinedSingleSGN-U214195---
Solanum tuberosumMultipleSGN-U243857---
ArabidopsisSingleAt1g30580 on TAIR---
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132176)
Chromosome
2
Position
5.91 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49211)
Chromosome
2
Position
15.32 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46579)
Chromosome
2
Position
46.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38163)
Chromosome
2
Position
0.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39445
Forward primer (5'-3')
TTCTGCCGAAGATTCATGCATGG
Accessions and product sizes
Solanum pennellii TA56
1000
Solanum lycopersicum TA209
1000
Approximate temperature
55°C
Reverse primer (5'-3')
TCTCTCCACAGCAGCACTGAAAGG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
550
Solanum lycopersicum TA209
850
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25163)
Chromosome
1
Position
10.83 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10150
Forward primer (5'-3')
TTCTGCCGAAGATTCATGCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCCACAGCAGCACTGAAAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 10151
Forward primer (5'-3')
TTCTGCCGAAGATTCATGCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCCACAGCAGCACTGAAAGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 10152
Forward primer (5'-3')
TTCTGCCGAAGATTCATGCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCCACAGCAGCACTGAAAGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12571
Forward primer (5'-3')
TTCTGCCGAAGATTCATGCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCCACAGCAGCACTGAAAGG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12572
Forward primer (5'-3')
TTCTGCCGAAGATTCATGCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCCACAGCAGCACTGAAAGG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12573
Forward primer (5'-3')
TTCTGCCGAAGATTCATGCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCCACAGCAGCACTGAAAGG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12574
Forward primer (5'-3')
TTCTGCCGAAGATTCATGCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCCACAGCAGCACTGAAAGG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 10153
Forward primer (5'-3')
TTCTGCCGAAGATTCATGCATGG
Digested band sizes (using RsaI)
Solanum pennellii LA716: 550
Solanum lycopersicum LA925: 850
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCCACAGCAGCACTGAAAGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI, HaeIII, HinfI
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Solanum lycopersicum LA925: 1000
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At1g30580 was used as an overgo probe on plate 12 [well F11]

Plausible BAC Matches:   P057M14,   P279K10,   P263O02,   P241L04,   P049P10,   P119B17

 Non-Plausible BAC matches

P306N14,   P097I09,   P264J07,   P212L16

 Overgo Sequences

A sequence
GGAGAGAAACCTTGCTGATATGCC
B sequence
TGCTGCTTCATCTGGTGGCATATC
AB sequence
GGAGAGAAACCTTGCTGATATGCCACCAGA
Marker sequence
ANNNNNTGCCACCAAAAGCAGCTAAAGGTAAAGAAGTTCCTGCCGAAAGG
CCGATTCTTGGCCGTTTCTCATCCCACTTGAAAATTGGAATCGTNNNNNA
GGATTACCCAATGTGGGGAAGTCTACTCTCTTCAACACACTGACAAAGTT
ATCCATTCCGGCAGAAAACTTTCCTTTTTGTACTATTGAGCCTAATGAAG
CTCGAGTGCACGTTCCTGATGAGCGTTTTGAATGGCTCTGTCAACTTTAC
AAGCCCAAGAGTGAGNNNNNGTGGCTGCCTTTTTGGAAATTCATGACATA
GCTGGACTTGTTCGAGGTGCTCATGCAGGACAAGGATTGGGGAACAGTTT
CTTATCCCACATCCGCGCAGTTGACGGCATTTTCCATGTTCTACGCNNNN
NGCATTTGAAGATCCAGATATTATCCATGTTGATGACACTGTTGATCCTG
TGAGAGACTTAGAGGTTATAAGTGAGGAACTAAGGCTTAAGGNNNNNACA
TCGAGTTCATGGAGAGAAGGATAGAAGATCTTGATAAGAGTATGAAGAGA
AGCAATGACAAACAATTGAAAATAGAGCATGAATTATGTCTAAGGGTCNN
NNNAAAGCATCACTCCAGGAAGGCAAAGATGTTCGTCTGGGGGACTGGAA
AGCTGCAGATGTTGAATTCTTGAATACCTTCCAGCTCCTTACTGCAAAAC
CAATTGTTTACTTGNNNNNGTNNNNNTAATATGAATGAGAAAGACTATCA
AAGGAAAAAGAACAAGTTTCTGCCGAAGATTCATGCATGGNNNNNGTGCA
GGAGCACGGTGGTGAAATAATTATTCCTTTCAGTGCTGCTGTGGAGAGAA
ACCTTGCTGATATGCCACCAGATGAAGCAGCAAAATACTGTGAAGAGAAC
AAGTTACAAAGNNNNNTTGCCTCCCAAAGATCATTAAGACTGGATTTGCA
GCCATTAATCTTATTTATTTCTTCACAGCAGGGCCAGATGAGGTNNNNNT
AAATGCTGGCAAATCCGCAGGCTGATGAAGGCTCCTCAAGCTGCTGGAAC
AATTCATACAGATTTTGAGAGAGGGTTCATCTGTGCTGAGGTNNNNNGAT
GAAATTTGAAGATCTAAAGGAACTTGGTAGTGAATCGGCTGTTAAGGNNN
NNCTGCTGGGAAGTATAAGCAGGAGGGTAAGACCTATGTGGTCCAAGATG
GTGATATTATATTCTTCAAGTTCAATGTCTCTGGGGGTGGGAAGAAGTGA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At1g30580  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3811 marker 3811
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)