SGN Marker TG567

SGN-M382

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG567 image not available
Forward sequence
TTTGACTGGTACTTTCAGCAATAACTCTTACATTCTACCTAGACCATTGGGTGATCAATGATTACTATGTTTTCTCCATACTAATGAAAA
AATGTGCAAATCGTGTCATTATTATAGCATGATGAAGATTTGATGTTCTTTGGTTTTATATGACTGCATTTTCTGCTGTTGATTATCTAC
TGACTACTGGTCATTGCTGTCATTTTGAAGCCGCCTCCACCAATTAACGACACGAATCCTTATAATGTATTTAGGCCAAGGGAGAAGGCC
CACAGACTTCATACAAGAAGGGTATTCAATTCTATGACTGTCCTAATCTTGTTGTGTAAAAGTTCTAATTGACAGATTAATTCTTGTGGA
ATTTTGTTTGTGTTAACGGAGAACCTGTGGCTTCCTGTTTTCTTTAACAGATGCCAAGGAGGGAAAACAATGCACAGGCATTTGAAAAGC
TTCGCCAGGTGAATCCTAGGACGAATTTTGCTCTTATTTCTTGATCT
Reverse sequence
GGAGACAAGCTTGCATGCCTGCAGCTGACAATTTGGCTGGATCCAGAGGTTTCGTAAACAGCAGAGTTGGCTCATTTGGATCCTGTATAA
CCCAATTTATGCAGTCTCGTCTTCAGTTTAATATTAACAAATGGATTAAGTTCAAGTAGCTTTCAACTCACATGCAAAGTAATTCGAACA
CTACATTTGAAAACATGTGTGATAAAGTGAGACAGTATAGGAAAGCAACTTTAGAGAGTAGGAAAGCACCAATTTATAGAGCCATCCATG
GGACACATTTCTTCGCTTGAACTCTCGCTTCATGATTCTAGGAGAAGCAGTCACCAGCTTCGGGTCCGGGAAGGTAATGTTTTGTGCTAT
ATGCCGACGGCTAGTAGAAGGATCATCAGAGTCGACAAATTCGTCCTCACTTGAACCAACCTTACTTGGGAAGGAAGGAAATTCAGGCAG
AGTAAAGGCATCCACAAAAAGCTCAGTTTCATTCTGGAATCCAAGAAAAGTAGATTAATTAATTCATGTAACATTCAAAATGAATAACCC
GAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1518915.7e-0751 (10.3% of RFLP seq)+
SGN-U1518912.5e-1553 (10.7% of RFLP seq)+
SGN-U1518901.6e-1651 (10.3% of RFLP seq)+
SGN-U1518901.3e-3888 (17.7% of RFLP seq)+
SGN-U1666556.5e-1064 (11.8% of RFLP seq)-
SGN-U1518906.7e-1337 (6.8% of RFLP seq)-
SGN-U1666551.1e-17133 (24.4% of RFLP seq)-
SGN-U1658571.2e-2050 (9.2% of RFLP seq)-
SGN-U1518902e-115237 (43.6% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9022)
Chromosome
2
Position
60.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG567 was used as an overgo probe on plate 16 [well H3]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P041A21,   P101E05,   P154P11,   P226B01,   P044O16,   P188B08,   P154M07,   P247G02

 Overgo Sequences

A sequence
TCTACTGACTACTGGTCATTGCTG
B sequence
GGCGGCTTCAAAATGACAGCAATG
AB sequence
TCTACTGACTACTGGTCATTGCTGTCATTT
Marker sequence
TTTGACTGGTACTTTCAGCAATAACTCTTACATTCTACCTAGACCATTGG
GTGATCAATGATTACTATGTTTTCTCCATACTAATGAAAAAATGTGCAAA
TCGTGTCATTATTATAGCATGATGAAGATTTGATGTTCTTTGGTTTTATA
TGACTGCATTTTCTGCTGTTGATTATCTACTGACTACTGGTCATTGCTGT
CATTTTGAAGCCGCCTCCACCAATTAACGACACGAATCCTTATAATGTAT
TTAGGCCAAGGGAGAAGGCCCACAGACTTCATACAAGAAGGGTATTCAAT
TCTATGACTGTCCTAATCTTGTTGTGTAAAAGTTCTAATTGACAGATTAA
TTCTTGTGGAATTTTGTTTGTGTTAACGGAGAACCTGTGGCTTCCTGTTT
TCTTTAACAGATGCCAAGGAGGGAAAACAATGCACAGGCATTTGAAAAGC
TTCGCCAGGTGAATCCTAGGACGAATTTTGCTCTTATTTCTTGATCT
Genomic location of TG567  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D382 marker 382
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)