SGN Marker C2_At5g08420

SGN-M3821
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300851 (SGN)
122771 (CGN)
---
Lycopersicon CombinedSingleSGN-U216217---
Solanum tuberosumMultipleSGN-U251101---
ArabidopsisSingleAt5g08420 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38762)
Chromosome
2
Position
36.60 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39912
Forward primer (5'-3')
TGTTGGCCTACTGTAAAAGGTGC
Accessions and product sizes
Solanum pennellii TA56
1300
Solanum lycopersicum TA209
1300
Approximate temperature
55°C
Reverse primer (5'-3')
TGAGGTGCAGGAACACTTCTTGAC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
530+700
Solanum pennellii TA56
580+700
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27070)
Chromosome
5
Position
2.71 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11667
Forward primer (5'-3')
TGTTGGCCTACTGTAAAAGGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGGTGCAGGAACACTTCTTGAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 11668
Forward primer (5'-3')
TGTTGGCCTACTGTAAAAGGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGGTGCAGGAACACTTCTTGAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 11669
Forward primer (5'-3')
TGTTGGCCTACTGTAAAAGGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGGTGCAGGAACACTTCTTGAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13663
Forward primer (5'-3')
TGTTGGCCTACTGTAAAAGGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGGTGCAGGAACACTTCTTGAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13664
Forward primer (5'-3')
TGTTGGCCTACTGTAAAAGGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGGTGCAGGAACACTTCTTGAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13665
Forward primer (5'-3')
TGTTGGCCTACTGTAAAAGGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGGTGCAGGAACACTTCTTGAC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13666
Forward primer (5'-3')
TGTTGGCCTACTGTAAAAGGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGGTGCAGGAACACTTCTTGAC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13667
Forward primer (5'-3')
TGTTGGCCTACTGTAAAAGGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGGTGCAGGAACACTTCTTGAC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 32651
Forward primer (5'-3')
TGTTGGCCTACTGTAAAAGGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGGTGCAGGAACACTTCTTGAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33183
Forward primer (5'-3')
TGTTGGCCTACTGTAAAAGGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGGTGCAGGAACACTTCTTGAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33184
Forward primer (5'-3')
TGTTGGCCTACTGTAAAAGGTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGGTGCAGGAACACTTCTTGAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 11670
Forward primer (5'-3')
TGTTGGCCTACTGTAAAAGGTGC
Digested band sizes (using DpnII)
Solanum lycopersicum LA925: 530+700
Solanum pennellii LA716: 580+700
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAGGTGCAGGAACACTTCTTGAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: DpnII
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At5g08420 was used as an overgo probe on plate 12 [well G12]

Plausible BAC Matches:   P027B01,   P251L24

 Overgo Sequences

A sequence
AAGCAGTGGGAAGAGAAGCAAGTC
B sequence
CCTTCTCAGCCTGTTTGACTTGCT
AB sequence
AAGCAGTGGGAAGAGAAGCAAGTCAAACAG
Marker sequence
ATGGCAGATGAGGAGAATTTAACAGTTAATGAAGAGTTGATTCCGAAGCC
GAGGCACAAGGGAAAACATGACAAACCAAAGCCATGGGATGATGAAAGCA
TTGATCATTGGAAGATTGAGAAGTTTGATCCTTCCTGGAACCAGAGTGGA
TTGCTTGAAGTCAGTTCGTTTTCAACTCTATTCCCTCAGTACAGAGAGAA
ATATTTGCAAGAGTGTTGGCCTACTGTAAAAGGTGCGTTGAAAGAGCATG
GAATTGCCTGCGAACTTAACTTGGTNNNNNTGAAGGATCTATGACAGTTT
CTACTACTATGAAGACAAGGGATCCCTATATTATTGTAAAAGCTAGGGAT
TTGATAAAACTTTTGTCAAGAAGTGTTCCTGCACCTCAGGNNNNNCTGTC
AAAATCCTGAATGATGAGATGCAATGTGACATAATCAAGATCGGCAACAT
GGTTCGCAACAAGGNNNNNAGCGCTTTGTTAAACGCAGACAATATCTTGT
GGGTCCCAATTCGTCAACTTTAAAGGNNNNNCCCTGGAAATTTTGACCGG
CTGCTATATCCTTGTCCAGGNNNNNGAAACACAGTTGCTGCTATGGGTTC
CTTTAAAGGTCTAAAGCAAGCGAGGAGGGTTATAGAGGACTGCATATTGA
ACAAGATGCATCCGCTACATCATATCAAGNNNNNATCCTCATGCTGAAGA
GAGAGCTTGCAAAAAATCCAGCTCTGGCTAGTGAGAACTGGGACAGATTT
CTTCCGCAATTTAAGAAGNNNNNAAGAACGTTAAACAGAAGAAAGTTCAG
AGCAAAGAAAAGAAACCATATACGCCTTTCCCACCTCCTCAGCCACCTAG
CAAGNNNNNATTGATCAACAACTGGAAAGTGGTGAATACTTCTTAAGTGA
CAAGAAGAAGATGGCAAAGCAGTGGGAAGAGAAGCAAGTCAAACAGGCTG
AGAAGGTTGCTGAAAACAAGAAAAAACGAGAAGAAGCTTTTGTTCCACCC
GAGGNNNNNAACCAAAAACACATAACCAAGATGTGTCCAACGTGGATAAA
GATGATGTCACTGCCATGGCATCGTCATTGNNNNNAAGAGAAAAGCAAAG
GAGTTCAGGAAGCAAAAATCAATTGATAAGATCAACGCTGAGGAATTTAT
TGCAGGTCCTAGCAAACCATCTAAAAAGAAATCGAAGAGCTCTAGATAAG
TAGTTGTCTCTTGGGAAAAGGTTGCTATTGGCCATTTGTGA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At5g08420  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3821 marker 3821
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)