SGN Marker C2_At4g38630

SGN-M3837
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301611 (SGN)
120144 (CGN)
---
Capsicum annuumSingleSGN-U199612---
Lycopersicon CombinedSingleSGN-U216576---
Solanum tuberosumSingleSGN-U244966---
ArabidopsisSingleAt4g38630 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38725)
Chromosome
2
Position
83.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39894
Forward primer (5'-3')
TGGCTGGTAAAGGGGTTCGAG
Accessions and product sizes
Solanum lycopersicum TA209
2000
Solanum pennellii TA56
2000
Approximate temperature
55°C
Reverse primer (5'-3')
AGCAAAAACAATAATCCTTTGTTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
800
Solanum pennellii TA56
920
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26961)
Chromosome
4
Position
18.06 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11600
Forward primer (5'-3')
TGGCTGGTAAAGGGGTTCGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAAAACAATAATCCTTTGTTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 11601
Forward primer (5'-3')
TGGCTGGTAAAGGGGTTCGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAAAACAATAATCCTTTGTTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 11602
Forward primer (5'-3')
TGGCTGGTAAAGGGGTTCGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAAAACAATAATCCTTTGTTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 13576
Forward primer (5'-3')
TGGCTGGTAAAGGGGTTCGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAAAACAATAATCCTTTGTTG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 2000
Approximate temperature
55°C
  
PCR data   Exp. ID 13577
Forward primer (5'-3')
TGGCTGGTAAAGGGGTTCGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAAAACAATAATCCTTTGTTG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13578
Forward primer (5'-3')
TGGCTGGTAAAGGGGTTCGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAAAACAATAATCCTTTGTTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13579
Forward primer (5'-3')
TGGCTGGTAAAGGGGTTCGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAAAACAATAATCCTTTGTTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13580
Forward primer (5'-3')
TGGCTGGTAAAGGGGTTCGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAAAACAATAATCCTTTGTTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13581
Forward primer (5'-3')
TGGCTGGTAAAGGGGTTCGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAAAACAATAATCCTTTGTTG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13582
Forward primer (5'-3')
TGGCTGGTAAAGGGGTTCGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAAAACAATAATCCTTTGTTG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 13583
Forward primer (5'-3')
TGGCTGGTAAAGGGGTTCGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAAAACAATAATCCTTTGTTG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 13584
Forward primer (5'-3')
TGGCTGGTAAAGGGGTTCGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAAAACAATAATCCTTTGTTG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 33149
Forward primer (5'-3')
TGGCTGGTAAAGGGGTTCGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAAAACAATAATCCTTTGTTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 33150
Forward primer (5'-3')
TGGCTGGTAAAGGGGTTCGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAAAACAATAATCCTTTGTTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33151
Forward primer (5'-3')
TGGCTGGTAAAGGGGTTCGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAAAACAATAATCCTTTGTTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 11603
Forward primer (5'-3')
TGGCTGGTAAAGGGGTTCGAG
Digested band sizes (using AluI)
Solanum lycopersicum LA925: 800
Solanum pennellii LA716: 920
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAAAAACAATAATCCTTTGTTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, TapI, HaeIII
  
Accessions and product sizes
Solanum lycopersicum LA925: 2000
Solanum pennellii LA716: 2000
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At4g38630 was used as an overgo probe on plate 12 [well D12]

Plausible BAC Matches:   P009K06,   P006N17,   P280A16,   P173M22,   P218J05,   P017C24,   P192P11,   P026J02,   P244I06

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GGATGAGAAACGGTGATTACTCGC
B sequence
GCTTGGAACCTATTGGGCGAGTAA
AB sequence
GGATGAGAAACGGTGATTACTCGCCCAATA
Marker sequence
ATGGTGCTCGAGGCGACAATGATCTGCATCGACAATTCGGAGTGGATGAG
AAACGGTGATTACTCGCCCAATAGGTTCCAAGCTCTAGCAGACGCTGTTA
ATCTAATCTGTGGTGCCAAAACCCAGNNNNNTCTAATCCCGAGAATACAG
TTGGAATTTTGACGATGGCTGGTAAAGGGGTTCGAGTGTTAGTCACTCCG
ACCAGCGATCTTGGAAAAATTTTAGCTTGTATGCACGGNNNNNATTGGAG
ATAGGCGGTGAGATGAATTTGGCTGCTGGAATCCAGGTAGCCCAGTTGGC
TTTGAAGCACCGACAAAACAAGAAGCAACAACAAAGGATTATTGTTTTTG
CTGGCAGNNNNNCCCTGTTAAATATGACAAGAAGGTCTTGGAGATGATTG
GGAGAAAGTTGAAGAAGAATAGTGTAGCTCTTGATGTGGTTAATTTTGGT
GAAGATGATGAAGGGAAAGCTGAGAAGCTAGAGGCACTAGTTGCTGCGCT
TAATACCAACGACAGTAGTCACATCATTCATATTCCTCCTGGTCCTAATG
CTCTCTCTGATGTTCTCATAAGNNNNNTACTCCTATTTTCACTGGTGATG
GAGAAGGTGGCAGTGGATTTGCTGCTGCTGCTGCAGCGGCTGCTGCTGGT
GGAGTGTCTGGATATGATTTTGGTGTAGATCCTAATTTGGATCCAGAACT
TGCTCTCGCACTCCGAGTTTCAATGGAGGAAGAAAGGGCGAGGCAGGAAG
CAGCTGCAAAGAAGGCTGCAGAAGAAGCTGGTAACCAAGAGAAAGGAGAA
AATCAGTCTACTTCTCAGGATGTTGCTATGGCTGAAAATGTCAATGCAGG
AACTTCTGAGCCTGAAANNNNNGCAAAGCAACTGACCTAATGGATGATGA
GAATGCCTTGTTACAGCAAGCCCTTGCAATGTCGATGGATGACTCGTCCT
CCAATGTTGCTACACGAGACACTGACATGTCAGAAGCGGCTTCTGAAGAT
CAAGACTTGGCACTTGNNNNNCTCTTCAACTGTCTGTGCAAGACAGTACA
AATGATCAGTCAAATCCGACAGATATGAGTAAGCTGTTGGCAGATCAATC
ATTTGTGTCATCAATCCTTGCCTCANNNNNCTTCCAGGTGTTGATCCAAA
CGATCCTTCTGTCAAAGATTTGCTTGCTTCCATGCAAGGGCAGTCCGAGN
NNNNAAGAAGGATGAGGACAATGATAAGGAACAGAAAGAGGACAAGAAGT
AA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Forward sequence for 68, AB1 chromatogram - [View]
Forward sequence for 68, PDF chromatogram
Forward sequence for 68, plain text
4g38630Fhab-4g38630F.ab1, AB1 chromatogram - [View]
4g38630Fhab-4g38630F.pdf, PDF chromatogram
4g38630Fhab-4g38630F.txt, plain text

Genomic location of C2_At4g38630  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3837 marker 3837
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)