SGN Marker C2_At5g60160

SGN-M3871
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304049 (SGN)
120004 (CGN)
---
Capsicum annuumSingleSGN-U202448---
Lycopersicon CombinedMultipleSGN-U215835---
Solanum tuberosumSingleSGN-U245458---
ArabidopsisSingleAt5g60160 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42267)
Chromosome
3
Position
89.60 cM
Confidence
I
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43836
Forward primer (5'-3')
ACACAATGCTAATCAACGTTATGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGACCACTGTGGTGCTCCCACATCAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38903)
Chromosome
3
Position
83.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 40005
Forward primer (5'-3')
ACACAATGCTAATCAACGTTATGC
Accessions and product sizes
Solanum pennellii TA56
450
Solanum lycopersicum TA209
500
Approximate temperature
55°C
Reverse primer (5'-3')
TCATCCACCGCGCACATTTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
450
Solanum pennellii TA56
400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27609)
Chromosome
5
Position
24.24 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 12055
Forward primer (5'-3')
ACACAATGCTAATCAACGTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATCCACCGCGCACATTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 12056
Forward primer (5'-3')
ACACAATGCTAATCAACGTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATCCACCGCGCACATTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12057
Forward primer (5'-3')
ACACAATGCTAATCAACGTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATCCACCGCGCACATTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12058
Forward primer (5'-3')
ACACAATGCTAATCAACGTTATGC
Digested band sizes (using amplicon difference)
Solanum pennellii LA716: 400
Solanum lycopersicum LA925: 450
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATCCACCGCGCACATTTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference(400-500, 500)
All possible enzymes for lycopersicum and pimpinellifolium: DraI, EcoRV, HinfI
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Solanum pennellii LA716: 450
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At5g60160  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3871 marker 3871
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)