SGN Marker C2_At5g52820

SGN-M3873
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308776 (SGN)
128467 (CGN)
---
Lycopersicon CombinedMultipleSGN-U218683---
Solanum tuberosumSingleSGN-U253314---
ArabidopsisSingleAt5g52820 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41542)
Chromosome
3
Position
109.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43518
Forward primer (5'-3')
TGGGATCTAAATACCCAGACACC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACAGAAAGAACCCAATTTCTGTGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38889)
Chromosome
3
Position
90.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39991
Forward primer (5'-3')
TGGGATCTAAATACCCAGACACC
Accessions and product sizes
Solanum lycopersicum TA209
750
Solanum pennellii TA56
750
Approximate temperature
55°C
Reverse primer (5'-3')
ACAGAAAGAACCCAATTTCTGTGC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
480
Solanum pennellii TA56
550
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27527)
Chromosome
5
Position
21.42 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 12006
Forward primer (5'-3')
TGGGATCTAAATACCCAGACACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAGAAAGAACCCAATTTCTGTGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12007
Forward primer (5'-3')
TGGGATCTAAATACCCAGACACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAGAAAGAACCCAATTTCTGTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12008
Forward primer (5'-3')
TGGGATCTAAATACCCAGACACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAGAAAGAACCCAATTTCTGTGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12009
Forward primer (5'-3')
TGGGATCTAAATACCCAGACACC
Digested band sizes (using RsaI)
Solanum lycopersicum LA925: 480
Solanum pennellii LA716: 550
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAGAAAGAACCCAATTTCTGTGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI, DraI
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At5g52820 was used as an overgo probe on plate 13 [well H3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TTGGCAAGTGGATCTGGTGACACT
B sequence
CCCACAAACGAACTGTAGTGTCAC
AB sequence
TTGGCAAGTGGATCTGGTGACACTACAGTT
Marker sequence
CACACTGAAGCTGTTCTTTCAGTTGCCTTCAGTCCTGATGGACGACAGTT
GGCAAGTGGATCTGGTGACACTACAGTTCGTTTGTGGGATCTAAATACCC
AGACACCATTGTTTACATGTCNNNNNAAGGGCACAGAAATTGGGTTCTTT
CTGTTGCATGGTCGCCAGATGGTAAGCATCTTGTTAGTGGAAGCAAGGCT
GGAGAACTTATCTGTTGGGACCTTCAGACTGGGAAGCCTTTAGGGAATCC
GCTTACNNNNNTGGCCACAAGAAATGGATAACTGGTATTTCTTGGGAACC
TGTACACCTCAGTGCTCCATGTCGCCGCTTTGTAAGTGCAAGTAAAGATG
GCGATGCACGGATATGGGATGTTATCACAAGGAAGTGTCTCATTTGTCTC
ACTGGCCATACACTTGCAATAACATGTGTAAAATGGGGTGGAGATGGAGT
TATATACACGGNNNNNGATCTCAGGACTGTACAATCAAGGTATGGGAAAC
CACGCAGGGGAAGCTAATACGTGAATTGANNNNNAGGGTCATGGACATTG
GGTAAATTCTCTAGCACTGAGCACTGAATATGTTCTTCGAAGTGGAGCTT
TTGATCACACCCATAAACACTTCGCATCTCCTGAGGAAATGAAAAAGGNN
NNNTAGCACTTGAAAGGTACAACAAAATGAGAGGTAATGCCCCTGAGAGG
TTGGTATCAGGATCAGATGATTTCACAATGTTTCTATGGGAGCCTGCTGT
CAGCAAGCACCCAAAAACTCGCATGACAGGTCNNNNNATCAACAGCTGGT
TAATCACGTTTATTTTTCTCCCGATGGTCAATGGATAGCAAGTGCCTCAT
TCGATAAGTCAGTAAAATTATGGGAN
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At5g52820  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3873 marker 3873
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)