Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker U214603

SGN-M3878

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U214603
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46792)
Chromosome
3
Position
52.20 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40202)
Chromosome
3
Position
106.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14040
Forward primer (5'-3')
ATTTCCCGAAAAATATCAAACCC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TCGCGCTCTTGACTGTTGAAAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 320
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 14040
Forward primer (5'-3')
ATTTCCCGAAAAATATCAAACCC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TCGCGCTCTTGACTGTTGAAAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 320
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
U214603 was used as an overgo probe on plate 12 [well H12]

Plausible BAC Matches:   P007M18,   P286D15,   P066J22

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CCTGATGCAAGGTAGAACCGTTCT
B sequence
CCTGTGAGCTATGACAAGAACGGT
AB sequence
CCTGATGCAAGGTAGAACCGTTCTTGTCAT
Marker sequence
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGAACTGGATGATGTCTGGTTTGCCTATCCATCCCGTCCTA
GCCACATGGTCCTCAAGGNNNNNGTATAACAATGAAGCTACAATCTGGTT
CAAAGGTTGCACTGGTTGGTCCAAGTGGTGGTGGAAAGNNNNNACTACAA
TAGCAAATTTGATAGAGAGATTCTATGATCCTGTTAAAGGGAAGATCTTG
CTCAATGGGGTTTCTGTGGTTGAAATATCTCATAAGCACCTACACCATAA
GNNNNNGTTAGTATAGTGAGCCAGGAACCTGTTCTTTTCAACTGTTCCAT
TGAAGAAAATATTGCCTATGGATTGGGCGGCAAAGCAAGCAGTGAAGATA
TAGAAAAAGCAGCTNNNNNANNNNNAAATGGCCAATGCTCATGAATTTGT
ATCCAAATTTCCCGAAAAATATCAAACCCATGTCGGAGAACGAGGATTAA
GACTTTCTGGTGGTCAGAAACAGAGAATAGCCATAGCTAGAGCACTACTG
ATGAACCCTACAATTTTATTGTTGGACGAGGCCACGAGTGCTCTGGATGC
TGAAAGTGAATATCTAGTTCAGGNNNNNATGCCATGGATTCCCTGATGCA
AGGTAGAACCGTTCTTGTCATAGCTCACAGGCTTTCAACAGTCAAGAGCG
CGAACACTGTAGCTGTTATTTCGGATGGTCAAATAGTGGAAAGTGGCACA
CATGATGACCTTCTGAACAAGAATGGGATCTATACAGCACTTGTGAGGAG
GCAGTTGCAGGGATACAAATCTGATAGCTAA
Genomic location of U214603  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3878 marker 3878
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)