SGN Marker TG200

SGN-M388

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1380
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG200 image not available
Forward sequence
CTCTAGAGTCCACCTGCAGCTGAGCCACTTGGCCTTTTCCGAATTAATGTTGAGCTGCCTGATATCATGATTAACAGAGCTAGAGTCTTC
TGGAGAAGACATTATTTCAAACCAATATTATAAGCTTAACTAATTCAAGTACCTTCGAATCTCATCCATCCTGTAACCTGAATTTCCATA
GTGTTAATTTCTTAGCTTTGGGAATCTTTTGAACCATCCAAGCAGCTTGTCTGAGATTTACAATTGAGTAGCAATTCTAGTTCATCAGAA
TTATGTATCAATCTTCAGTTAACAAAATAATATGAGGATTAAATAGAAAAAATAGAATGTTATATCATTCATAACGGTATAACTGCTCTT
TAAATTTAAATGTACATTTGAATATTCACATTCAAATGAATTGGTGGGTTCACAACAAAGTAAACAGACTTAGTATTTGGAATAACATGA
GACACAACGATTCACTACGAAAAGTGGAATAATTGCTTCAGGACATCACACTGTATTA
Reverse sequence
GCCTGCAGTTGTGCAGCTTCACTGCCTTTAGAGTAAACTGGCAGAAATGTAGATACACTTGAAACTTCTATTATGAGTGAACAGAACGAG
CACCTTATTCGAACTTTTATTATGTCCAACTGTCACACAAAGGAAGCACTACTCTTCATTTCCTGGCCTCTAAAAATTCCATGACATAAG
CAAGAGTGGAATTAGGGAAATCGAAAAGCCGCATGAATAACAAATATCAAAATTCAAAACCGAATAGAACATGTAACATAGAAAACAAGA
ACACAAAAAATAAGGAACATGATGAAAGGATATGCTGTATTTCTCTCCTTGAATAAAATGGCACACACTTCATCAAAGGCATAAAATCAT
GCAGCATCAACTTTCAGCAGCTTTTTCTTGATGGAATCTGATGAAAATATTTTTAAAGGACTTGCTTTTAGGAAATGAAATTGTAAGGGA
TAAGAAAGATGCCACATTTTGTAACTCTAGAAAAATCAATCC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9038)
Chromosome
3
Position
46.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG200 was used as an overgo probe on plate 3 [well E8]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
AGCCACTTGGCCTTTTCCGAATTA
B sequence
TCAGGCAGCTCAACATTAATTCGG
AB sequence
AGCCACTTGGCCTTTTCCGAATTAATGTTG
Marker sequence
CTCTAGAGTCCACCTGCAGCTGAGCCACTTGGCCTTTTCCGAATTAATGT
TGAGCTGCCTGATATCATGATTAACAGAGCTAGAGTCTTCTGGAGAAGAC
ATTATTTCAAACCAATATTATAAGCTTAACTAATTCAAGTACCTTCGAAT
CTCATCCATCCTGTAACCTGAATTTCCATAGTGTTAATTTCTTAGCTTTG
GGAATCTTTTGAACCATCCAAGCAGCTTGTCTGAGATTTACAATTGAGTA
GCAATTCTAGTTCATCAGAATTATGTATCAATCTTCAGTTAACAAAATAA
TATGAGGATTAAATAGAAAAAATAGAATGTTATATCATTCATAACGGTAT
AACTGCTCTTTAAATTTAAATGTACATTTGAATATTCACATTCAAATGAA
TTGGTGGGTTCACAACAAAGTAAACAGACTTAGTATTTGGAATAACATGA
GACACAACGATTCACTACGAAAAGTGGAATAATTGCTTCAGGACATCACA
CTGTATTA
Genomic location of TG200  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D388 marker 388
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)