SGN Marker FA

SGN-M3880
KFG markers are Known Function Genes

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39091)
Chromosome
3
Position
135.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35574
Forward primer (5'-3')
AGGGGAAGAGGATGAGGAAA
Digested band sizes (using EcoRI)
Solanum pennellii LA716: 900
Solanum lycopersicum LA925: 850
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCACCAATGGCTTGTAAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 900
Solanum lycopersicum LA925: 900
Approximate temperature
Unknown
  
Genomic location of FA  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3880 marker 3880
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)