SGN Marker C3

SGN-M3893
KFG markers are Known Function Genes

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38925)
Chromosome
4
Position
56.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35566
Forward primer (5'-3')
GGGTGTGTACCCAAACCAAC
Digested band sizes (using EcoRV)
Solanum lycopersicum LA925: 912
Solanum pennellii LA716: 800
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGCACTCCTTACTCCCATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 912
Solanum pennellii LA716: 912
Approximate temperature
60°C
  
Genomic location of C3  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3893 marker 3893
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)