SGN Marker TR2

SGN-M3899
KFG markers are Known Function Genes

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40178)
Chromosome
4
Position
55.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35637
Forward primer (5'-3')
AGCTCCAAGTGCCGAAGTTA
Digested band sizes (using Tsp509I)
Solanum pennellii LA716: 400
Solanum lycopersicum LA925: 350
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTCTTCATCCGACCTGTCA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 800
Solanum lycopersicum LA925: 800
Approximate temperature
55°C
  
Genomic location of TR2  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3899 marker 3899
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)