SGN Marker TG22

SGN-M39

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2700
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TAGAGTCGACCTGCAGCAGCAAACGCAGCCTTCTCTTCCTCAGACATGGGAAAATTTTGTGTTTCCTCACTGGTATCATTTTGCCTTCCT
ACTGAAGCTTGAGAGGTTGACGGTTCAACAACTGGAATAGCTCCTATCGTGGCTGGCCTGACATTCAGCTTCTTGTTGTTGACACTAACA
GCTAAGTGATTTCCAGCCGATGAAGAAACTTTAGAACTCCGTTTACTGTCTACTGCTGAAGGATGACTGCGGATAGGAGGTTTGCCAGGT
GCTGCAATGTGTTTGCTCTTCGAAGTATCAGTGGCAGTGGATTGTCTTAGTAATTTCAGACCACCATTAGCAGCCTTCTCCTTTCGAAAA
AGTTCTATCCATACATTGACAAGCTGACTTGCTACAGCACGTATGTCACGGCTAGTATGCACACAGACTTTTTCTTTAACCGTTTTCCCA
ATACCTGGATAAAATATGACAGGAATAGAATCAGTTAAATCAATGCAAGGACAAAGCAATACGCTAATGATATGACAATTATAAGGATCA
TTAGCCATTAATGGATATAGAAAGCAAATATTTTGAGTTTATAGCATACAAGCTGAAAAATATGAAACATTAACAGAGAATATTGATAGC
CCCGATGGGGTTGTGCACATAAATAATTTGAAGGTACAAATCAGC
Reverse sequence
CCTGAAGCGCCAAGGTTTCCATGTCACCGTGCTCGAGGCCAGAAGTAGAATAGGTGGTCGTGTTTTTACAGATCGCTCGTCTCTATCTGT
TCCAGTGGACCTTGGTGCTAGCATTATTACTGGTATTGAGGCAGATGTGGCGACTGAAAGAAGACCAGATCCTTCTTCGTTGATTTGTGC
ACAGTTGGGTCTTGAATTGACTGTATTGAACAGTGATTGTCCCCTGTACGATGTAGCTACTGGCCAGAAAGTACCAGTAGATCTGGATGA
AGCATTGGAAGCAGAATTCAATAGCTTATTGGATGACATGGTACTGTTGGTTGCTCAAAAAGGGGAGCATGCGATGCGGATGTCCCTGGA
GGATGGTTTGGAATATGCCCTTAAGAAGCGTCAGAAGGCCCGGTTTGCGAGAAATCATATGGGTAATGAATCACAAAAATTATCAGTGAC
AGCAGTGGAATCCATGGCACTTTCTGATGTCGGAGTTCCTCAAAATAATAATTCTAAGGTAGAGATCTTGAGCCCCCCAGAGAGGAGGGT
AATGGATTGGCATTTTGCTAACTTGGAGTATGGTTGTGCTGCATTGCTTAAAGAAGTCTCTCTTCCT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1720853.9e-98180 (26.7% of RFLP seq)+
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53221)
Chromosome
4
Position
73.80 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39945)
Chromosome
3
Position
0.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Pepper-FAO3   
Map version
31 (location: 7839)
Chromosome
3
Position
52.72 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-FAO3

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7836)
Chromosome
4
Position
119.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 7840)
Chromosome
4
Position
60.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG22 was used as an overgo probe on plate 9 [well E9]

Plausible BAC Matches:   P323C10,   P161O13

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GGTGCTGCAATGTGTTTGCTCTTC
B sequence
CTGCCACTGATACTTCGAAGAGCA
AB sequence
GGTGCTGCAATGTGTTTGCTCTTCGAAGTA
Marker sequence
TAGAGTCGACCTGCAGCAGCAAACGCAGCCTTCTCTTCCTCAGACATGGG
AAAATTTTGTGTTTCCTCACTGGTATCATTTTGCCTTCCTACTGAAGCTT
GAGAGGTTGACGGTTCAACAACTGGAATAGCTCCTATCGTGGCTGGCCTG
ACATTCAGCTTCTTGTTGTTGACACTAACAGCTAAGTGATTTCCAGCCGA
TGAAGAAACTTTAGAACTCCGTTTACTGTCTACTGCTGAAGGATGACTGC
GGATAGGAGGTTTGCCAGGTGCTGCAATGTGTTTGCTCTTCGAAGTATCA
GTGGCAGTGGATTGTCTTAGTAATTTCAGACCACCATTAGCAGCCTTCTC
CTTTCGAAAAAGTTCTATCCATACATTGACAAGCTGACTTGCTACAGCAC
GTATGTCACGGCTAGTATGCACACAGACTTTTTCTTTAACCGTTTTCCCA
ATACCTGGATAAAATATGACAGGAATAGAATCAGTTAAATCAATGCAAGG
ACAAAGCAATACGCTAATGATATGACAATTATAAGGATCATTAGCCATTA
ATGGATATAGAAAGCAAATATTTTGAGTTTATAGCATACAAGCTGAAAAA
TATGAAACATTAACAGAGAATATTGATAGCCCCGATGGGGTTGTGCACAT
AAATAATTTGAAGGTACAAATCAGC
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG22  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D39 marker 39
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)