SGN Marker U49812

SGN-M3903

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U49812
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40261)
Chromosome
4
Position
64.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14105
Forward primer (5'-3')
CAGGAAAAGCAAAGCCAAAG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TCAAGCTGAGCATGCTTTTT
Enzymes
  
Accessions and product sizes
Approximate temperature
Unknown
  
Genomic location of U49812  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3903 marker 3903
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)