SGN Marker C2_At5g10920

SGN-M3908
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310800 (SGN)
132486 (CGN)
---
Lycopersicon CombinedSingleSGN-U242840---
Solanum tuberosumSingleSGN-U252595---
ArabidopsisSingleAt5g10920 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46747)
Chromosome
4
Position
62.90 cM
Confidence
I(LOD2)
Protocol
PCR


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46523)
Chromosome
4
Position
50.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38771)
Chromosome
4
Position
88.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39916
Forward primer (5'-3')
TATCATGGGTAGTAAAGCTCATGC
Accessions and product sizes
Solanum pennellii TA56
300
Solanum lycopersicum TA209
300
Approximate temperature
55°C
Reverse primer (5'-3')
TTGCCTCTCTATCTCTTCAAGACC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
220
Solanum lycopersicum TA209
170
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27097)
Chromosome
5
Position
3.44 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11680
Forward primer (5'-3')
TATCATGGGTAGTAAAGCTCATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCCTCTCTATCTCTTCAAGACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 11681
Forward primer (5'-3')
TATCATGGGTAGTAAAGCTCATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCCTCTCTATCTCTTCAAGACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 11682
Forward primer (5'-3')
TATCATGGGTAGTAAAGCTCATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCCTCTCTATCTCTTCAAGACC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 11683
Forward primer (5'-3')
TATCATGGGTAGTAAAGCTCATGC
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 170
Solanum pennellii LA716: 220
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTGCCTCTCTATCTCTTCAAGACC
Enzymes
All possible enzymes for pennellii and and lycopersicum: DraI
  
Accessions and product sizes
Solanum lycopersicum LA925: 300
Solanum pennellii LA716: 300
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At5g10920 was used as an overgo probe on plate 13 [well B6]

Plausible BAC Matches:   P235H02,   P182P12,   P254D03,   P277F08,   P232A20,   P272I08

 Overgo Sequences

A sequence
GTTTCGAAGAGAGCGTTACCGATG
B sequence
GTGAACTTCTCCACAGCATCGGTA
AB sequence
GTTTCGAAGAGAGCGTTACCGATGCTGTGG
Marker sequence
TCTTTGACAACTTCCCCCATTTTCTCTTCATCCAAACACGCCCTTACTCC
TAAACCCCAAAGCCTCTCTTTCAACTCCAATGCTCGTTTAGTATTGTTCA
CCTGTGCAGCGCAGCAGATGAATTCACCACCCTCTACGGCGGCGACGACG
GCGGAAAAGGAAGTGAAGCTATGGGGTGGCCGTTTCGAAGAGAGCGTTAC
CGATGCTGTGGAGAAGTTCACTGAGTCCATTTCGTTTGATAAAGCTCTCT
ATAAACAGGATATCATGGGTAGTAAAGCTCATGCTTCAATGCTTGCTAAA
CAGNNNNNGGATTGATGAGTGATATTGATAGAGATACTATCATAAAAGGT
CTTGAAGAGATAGAGAGGCAAATTGAGGCAGGTGAATTTGTATGGAGAAC
AGATAGAGAGGATGTGCATATGAATATTGAAGCAGCACTTACTGATTTGG
TTGGTGAACCTGCCAAAAAGCTTCACACTGCCCGGAGTAGAAATGATCAG
GTTGCAACTGATTTTCGCTTGTGGTGTCGTGATGCTATTGACGGAATCAT
TTCACGCATTAAGAATCTTCANNNNNNNNNNNNNNNN
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At5g10920  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3908 marker 3908
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)