SGN Marker TG201

SGN-M391

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
540
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AATACCAAGATTTAGAAAGCTGGTATCTTTCTTTCTTGCCTACAACAACCTCCGTTAGTTCTCGTGAGGCACCACGTTTGATATATTCCT
ATCGAAATGTCTTAACAGGCTTTGCAGCTAAGTTATCAGAAGAAGATATAAAGGAAATGGAAAAAAAGGAAGGATTTGTTTCTGCACGCC
CCCAGCAGTTTGTTAGTTTACACACCACACATAGTGTCAATTTCTTGGGATTGCAACAGAACATGGGGTTCTGGAAAGACTCTAATTATG
GGAAAGGTGTGATCATCGGAGTTCTAGACACTGGAATTCTTCCTGACCATCCTTCATTTAGTGACGTTGGGATGCCTACCCCACCTGCTA
AGTGGAAAGGAGTTTGTGAGTCAAATTTTATGAACAAGTGTAACAAAAAGCTCATTGGAGCGAGGTCTTACCAACTTGGCAATGGTTCCC
CGATAGATGGTAATGGACACGGTACACACACAGCAAGCACAGCTGCAGGCATG
Reverse sequence
CTCACTATAGGGAGACAGCCTGCATGCCTACAGCTGTGCTTGCTGTGTGTGTACCGTGTCCATTACCATCTATCGGGGAACCATTGCCAA
GTTGGTAAGACCTCGCTCCAATGAGCTTTTTGTTACACTTGTTCATAAAATTTGACTCACAAACTCCTTTCCACTTAGCAGGTGGGGTAG
GCATCCCAACGTCACTAAATGAAGGATGGTCAGGAAGAATTCCAGTGTCTAGAACTCCGATGATCACACCTTTCCCATAATTAGAGTCTT
TCCAGAACCCCATGTTCTGTTGCAATCCCAAGAAATTGACACTATGTGTGGTGTGTAAACTAACAAACTGCTGGGGGCGTGCAGAAACAA
ATCCTTCCTTTTTTTCCATTTCCTTTATATCTTCTTCTGATAACTTAGCTGCAAAGCCTGTTAAGACATTTCGATAGGAATATATCAAAC
GTGGTGCCTCACGAGAACTAACGGAGGTTGTTGTAGGCAAGAAAGAAAGATACCAGCTTTCTAAATCTTGGTATT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1732959e-0677 (15.3% of RFLP seq)+
SGN-U1631591.7e-1980 (15.9% of RFLP seq)+
SGN-U1537983.6e-42150 (29.8% of RFLP seq)+
SGN-U1732959.4e-0677 (14.7% of RFLP seq)-
SGN-U1631591.8e-1980 (15.2% of RFLP seq)-
SGN-U1537983.7e-42150 (28.6% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53524)
Chromosome
8
Position
67.01 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9042)
Chromosome
8
Position
70.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 9043)
Chromosome
8
Position
70.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG201 was used as an overgo probe on plate 12 [well A7]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P161B07,   P236D02,   P259F18,   P150P16,   P313I07,   P066O08,   P310O08,   P267L06,   P004P13,   P069C15,   P023O15,   P102J24,   P073B04,   P165B06,   P020K14,   P036F16

 Overgo Sequences

A sequence
CAACAACCTCCGTTAGTTCTCGTG
B sequence
ATCAAACGTGGTGCCTCACGAGAA
AB sequence
CAACAACCTCCGTTAGTTCTCGTGAGGCAC
Marker sequence
AATACCAAGATTTAGAAAGCTGGTATCTTTCTTTCTTGCCTACAACAACC
TCCGTTAGTTCTCGTGAGGCACCACGTTTGATATATTCCTATCGAAATGT
CTTAACAGGCTTTGCAGCTAAGTTATCAGAAGAAGATATAAAGGAAATGG
AAAAAAAGGAAGGATTTGTTTCTGCACGCCCCCAGCAGTTTGTTAGTTTA
CACACCACACATAGTGTCAATTTCTTGGGATTGCAACAGAACATGGGGTT
CTGGAAAGACTCTAATTATGGGAAAGGTGTGATCATCGGAGTTCTAGACA
CTGGAATTCTTCCTGACCATCCTTCATTTAGTGACGTTGGGATGCCTACC
CCACCTGCTAAGTGGAAAGGAGTTTGTGAGTCAAATTTTATGAACAAGTG
TAACAAAAAGCTCATTGGAGCGAGGTCTTACCAACTTGGCAATGGTTCCC
CGATAGATGGTAATGGACACGGTACACACACAGCAAGCACAGCTGCAGGC
ATG
Genomic location of TG201  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D391 marker 391
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)