SGN Marker C2_At2g01110

SGN-M3927
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310764 (SGN)
125518 (CGN)
---
Capsicum annuumSingleSGN-U202030---
Lycopersicon CombinedSingleSGN-U220240---
Solanum tuberosumSingleSGN-U263209---
ArabidopsisSingleAt2g01110 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49224)
Chromosome
5
Position
2.86 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47155)
Chromosome
5
Position
38.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46623)
Chromosome
10
Position
86.90 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41364)
Chromosome
11
Position
0.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43340
Forward primer (5'-3')
ATTTGTGCTCGTACTCATGTTCAG
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
TCCAAATCGACAGCATTTGATCTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38283)
Chromosome
5
Position
37.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39549
Forward primer (5'-3')
ATTTGTGCTCGTACTCATGTTCAG
Accessions and product sizes
Solanum lycopersicum TA209
650
Solanum pennellii TA56
650
Approximate temperature
55°C
Reverse primer (5'-3')
TCCAAATCGACAGCATTTGATCTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
500
Solanum lycopersicum TA209
400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25549)
Chromosome
2
Position
0.08 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10494
Forward primer (5'-3')
ATTTGTGCTCGTACTCATGTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAATCGACAGCATTTGATCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 10495
Forward primer (5'-3')
ATTTGTGCTCGTACTCATGTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAATCGACAGCATTTGATCTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 10496
Forward primer (5'-3')
ATTTGTGCTCGTACTCATGTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAATCGACAGCATTTGATCTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 12891
Forward primer (5'-3')
ATTTGTGCTCGTACTCATGTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAATCGACAGCATTTGATCTC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 720
Approximate temperature
55°C
  
PCR data   Exp. ID 12892
Forward primer (5'-3')
ATTTGTGCTCGTACTCATGTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAATCGACAGCATTTGATCTC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 720
Approximate temperature
55°C
  
PCR data   Exp. ID 12893
Forward primer (5'-3')
ATTTGTGCTCGTACTCATGTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAATCGACAGCATTTGATCTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 720
Approximate temperature
55°C
  
PCR data   Exp. ID 12894
Forward primer (5'-3')
ATTTGTGCTCGTACTCATGTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAATCGACAGCATTTGATCTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 720
Approximate temperature
55°C
  
PCR data   Exp. ID 12895
Forward primer (5'-3')
ATTTGTGCTCGTACTCATGTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAATCGACAGCATTTGATCTC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 720
Approximate temperature
55°C
  
PCR data   Exp. ID 12896
Forward primer (5'-3')
ATTTGTGCTCGTACTCATGTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAATCGACAGCATTTGATCTC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 12897
Forward primer (5'-3')
ATTTGTGCTCGTACTCATGTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAATCGACAGCATTTGATCTC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 480
Approximate temperature
55°C
  
PCR data   Exp. ID 12898
Forward primer (5'-3')
ATTTGTGCTCGTACTCATGTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAATCGACAGCATTTGATCTC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 480
Approximate temperature
55°C
  
PCR data   Exp. ID 32616
Forward primer (5'-3')
ATTTGTGCTCGTACTCATGTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAATCGACAGCATTTGATCTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 720
Approximate temperature
55°C
  
PCR data   Exp. ID 32886
Forward primer (5'-3')
ATTTGTGCTCGTACTCATGTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAATCGACAGCATTTGATCTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 720
Approximate temperature
55°C
  
PCR data   Exp. ID 32887
Forward primer (5'-3')
ATTTGTGCTCGTACTCATGTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAATCGACAGCATTTGATCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 720
Approximate temperature
55°C
  
PCR data   Exp. ID 32888
Forward primer (5'-3')
ATTTGTGCTCGTACTCATGTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAATCGACAGCATTTGATCTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 720
Approximate temperature
55°C
  
PCR data   Exp. ID 32889
Forward primer (5'-3')
ATTTGTGCTCGTACTCATGTTCAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAATCGACAGCATTTGATCTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 720
Approximate temperature
55°C
  
PCR data   Exp. ID 10497
Forward primer (5'-3')
ATTTGTGCTCGTACTCATGTTCAG
Digested band sizes (using HaeIII)
Solanum lycopersicum LA925: 400
Solanum pennellii LA716: 500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAAATCGACAGCATTTGATCTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: HaeIII
  
Accessions and product sizes
Solanum pennellii LA716: 650
Solanum lycopersicum LA925: 650
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At2g01110 was used as an overgo probe on plate 13 [well C2]

Plausible BAC Matches:   P237P14,   P294K10,   P237E15,   P006L06,   P055G23,   P251J14,   P255M10,   P309L13,   P081N16,   P282K01,   P313F03,   P271P05,   P041C18,   P244P17

 Overgo Sequences

A sequence
CTTTACTTGGGTGGAGCATGGATG
B sequence
GCCCAGAAAGCTTAACCATCCATG
AB sequence
CTTTACTTGGGTGGAGCATGGATGGTTAAG
Marker sequence
ATGGGAAGTTCAAGTGCTCTCATCTCAAATCTTCACCTGACTCAAACTAA
CTGTTTCAAATGCTTGAATTCAAGAACTTCTCTGAATATCAACCCCACAA
GGCCAAAATTGAATCTTTCTAGCAGAAAATGCATCAAAAAGTTCAGCAGA
CTTGTTTGTTCTGCTGTTGAAGATTCCATGGAGAAACAGAGAGAAATTAG
TGGAGCAAATGCTAGCAGTCTTGGTTCAGCTGTTGAAGATAGACCTGATG
TCGGTGATGGCTCAAGCAAGAGTTTATTTAAGAACGNNNNNGTGGATCAG
ATAGTGAAGGGAATGTTGTTTATGATTTCCTTTACCCTAATAAAGAGCTG
CTACCAGATGATAAAGAAATGACTCTATTTGATCATTTGGAGGAGTTGCG
CCAGAGACTCTTTGTGTCTGTTTTGGCCGTTGGTGCTGCTATAGTGGGAT
GTTTTGCCTTCTCAAAAGAACTTATCTTGATTCTTGAAGCCCCTGTTCTA
GCACAAGGTGTTCGATTTTTGCAACTAGGTCCAGGAGAGTTCTTTTTCAC
TACTTTAAAANNNNNGTCTCAGGATATAGTGGCCTTCTCTTAGGAGCTCC
TGTGATTCTCTACGAGATCATAGCCTTCGTTCTTCCTGGTTTGACAATGT
CAGAAAGAAGATTCCTGGCACCAATTGTCCTTGGATCCTCTGTTCTTTTC
TATGCCGGCATTGTTTTCTCACACTTGGTCCTCACTCCAGCAGCCTTGAA
TTTCTTTGTTAATTATGCAGAAGGGGCTGTGGAATCTTTTTGGTCCATTG
ATCAATACTTCGAATTTGTGCTCGTACTCATGTTCAGTACAGGGTTGTCT
TTCCAGNNNNNGTTCCTGTCATTCAACTGCTTCTGGGACAAACTGGTCTT
GTGTCAGGAGATCAAATGCTGTCGATTTGGAGATACGTGGTGGTAGGTGC
TGTCGTTGCTGCTGCAGTGCTCACACCATCAACTGATCCCCTTACTCAAA
TGCTTCTAGCTGGCCCACTTTTAGGTCTTTACTTGGGTGGAGCATGGATG
GTTAAGCTTTCTGGGCGATAA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120061 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, plain text
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120060 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120060 plant #1, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text


BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120061 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, plain text
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120060 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120060 plant #1, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At2g01110  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D3927 marker 3927
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)